ID: 1130991191

View in Genome Browser
Species Human (GRCh38)
Location 15:88877114-88877136
Sequence GACCGGGTGAACCATTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130991185_1130991191 -4 Left 1130991185 15:88877095-88877117 CCACTAGGCCAGCACCCAGGACC 0: 1
1: 0
2: 4
3: 41
4: 231
Right 1130991191 15:88877114-88877136 GACCGGGTGAACCATTGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1130991183_1130991191 2 Left 1130991183 15:88877089-88877111 CCTCTGCCACTAGGCCAGCACCC 0: 1
1: 0
2: 2
3: 35
4: 221
Right 1130991191 15:88877114-88877136 GACCGGGTGAACCATTGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1130991182_1130991191 8 Left 1130991182 15:88877083-88877105 CCAGGTCCTCTGCCACTAGGCCA 0: 1
1: 0
2: 2
3: 19
4: 185
Right 1130991191 15:88877114-88877136 GACCGGGTGAACCATTGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130991191 Original CRISPR GACCGGGTGAACCATTGAGC AGG Intergenic