ID: 1130991193

View in Genome Browser
Species Human (GRCh38)
Location 15:88877119-88877141
Sequence GGTGAACCATTGAGCAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130991183_1130991193 7 Left 1130991183 15:88877089-88877111 CCTCTGCCACTAGGCCAGCACCC 0: 1
1: 0
2: 2
3: 35
4: 221
Right 1130991193 15:88877119-88877141 GGTGAACCATTGAGCAGGCAAGG 0: 1
1: 0
2: 2
3: 26
4: 321
1130991185_1130991193 1 Left 1130991185 15:88877095-88877117 CCACTAGGCCAGCACCCAGGACC 0: 1
1: 0
2: 4
3: 41
4: 231
Right 1130991193 15:88877119-88877141 GGTGAACCATTGAGCAGGCAAGG 0: 1
1: 0
2: 2
3: 26
4: 321
1130991182_1130991193 13 Left 1130991182 15:88877083-88877105 CCAGGTCCTCTGCCACTAGGCCA 0: 1
1: 0
2: 2
3: 19
4: 185
Right 1130991193 15:88877119-88877141 GGTGAACCATTGAGCAGGCAAGG 0: 1
1: 0
2: 2
3: 26
4: 321
1130991188_1130991193 -7 Left 1130991188 15:88877103-88877125 CCAGCACCCAGGACCGGGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1130991193 15:88877119-88877141 GGTGAACCATTGAGCAGGCAAGG 0: 1
1: 0
2: 2
3: 26
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130991193 Original CRISPR GGTGAACCATTGAGCAGGCA AGG Intergenic