ID: 1130992025

View in Genome Browser
Species Human (GRCh38)
Location 15:88881335-88881357
Sequence GGTGAGATGCTAACGGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130992025 Original CRISPR GGTGAGATGCTAACGGGGAC TGG (reversed) Exonic
900686366 1:3950684-3950706 GGGGAGATGCAAAAGGGGAATGG + Intergenic
902585168 1:17434611-17434633 GGTCAGAAGCTACCAGGGACTGG + Intronic
903950449 1:26993480-26993502 GGGGAGAGGCGAAAGGGGACCGG + Intergenic
904420339 1:30387028-30387050 GGTGACATGCTAATGAGGACTGG - Intergenic
906138151 1:43515040-43515062 GGAGAGATGCTAAAGGGGCATGG - Intergenic
906321967 1:44822716-44822738 AGCGAGATGCTAAAGGGGACGGG - Intronic
915634161 1:157174616-157174638 GGTGAGATGCCGCCTGGGACAGG + Intergenic
915637994 1:157199696-157199718 GGTGAGATGCTGCCTGGGACAGG + Intergenic
915985745 1:160462460-160462482 AGTGAGGTGATAACAGGGACTGG + Intergenic
919781223 1:201222521-201222543 GGGGAGATGCTAGCGGGGGAGGG - Intronic
1065216165 10:23450942-23450964 GTTGAGAAGCTGATGGGGACCGG - Intergenic
1065659348 10:27989603-27989625 GGTGAGAAGCCAAAGGGCACAGG + Intronic
1075658171 10:124175372-124175394 GCTGAGATGCTACCCGGGAAGGG + Intergenic
1076523474 10:131095290-131095312 GGAGAGCAGCTACCGGGGACTGG - Intronic
1077477558 11:2797580-2797602 GGTCAGATGCTAGTGGGGAAAGG - Intronic
1078722559 11:13897944-13897966 GGAGAGATGCTAAAAGGGGCAGG + Intergenic
1079307183 11:19333811-19333833 GCTGAGATGCCAAACGGGACAGG + Intergenic
1084055013 11:66626374-66626396 GGGGAGATGCCAATGGGGACAGG - Intronic
1084887686 11:72221688-72221710 GGTGAGATGCTTCATGGGACTGG + Exonic
1088910248 11:114185449-114185471 GGTGGGTGGCTAACTGGGACAGG + Intronic
1089042045 11:115461424-115461446 GGTGAGCAGCTAACGGGGAATGG + Intronic
1096101894 12:48974536-48974558 GGTGAGATGTTAGAGGGGAGAGG - Intergenic
1100611061 12:96192918-96192940 TGTGAGCTGCTAAAGGGCACGGG - Intergenic
1103047969 12:117754244-117754266 CGTGAGATACTACTGGGGACAGG + Intronic
1105535173 13:21259322-21259344 TGTGAGCTGCTACCGGGGACGGG + Intergenic
1109476574 13:62887066-62887088 GGTGAGGTGCTGACGGGCATAGG + Intergenic
1113482215 13:110629440-110629462 GAGCAGATGCTAACGGGGATGGG - Intronic
1114183010 14:20381229-20381251 GTGGAGATGGTAACGGGGAGAGG + Intronic
1122288162 14:100665004-100665026 GGAGAGGTGCTAACTGGCACAGG - Intergenic
1123496662 15:20833689-20833711 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1123553897 15:21407281-21407303 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1123590141 15:21844646-21844668 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1130992025 15:88881335-88881357 GGTGAGATGCTAACGGGGACTGG - Exonic
1131130907 15:89899662-89899684 GGTGAGAGGCTAGAGGGGTCTGG - Exonic
1202962243 15_KI270727v1_random:134477-134499 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1137724201 16:50646100-50646122 GACAAGATGCTAACGGGGGCGGG + Intergenic
1138631173 16:58295325-58295347 TGTAAGATGCTGACGGGGACTGG - Intronic
1139349702 16:66327420-66327442 GGGGTGATGCTGATGGGGACAGG + Intergenic
1139420488 16:66846669-66846691 GGTGAGATACTGATGGGGTCAGG + Intronic
1140246239 16:73252548-73252570 GGTGAGATGCACAGGGGCACTGG + Intergenic
1146186669 17:30728814-30728836 GGGGAGATGCGGACGGGGGCTGG + Intergenic
1146644759 17:34569812-34569834 GGTGAGATGGAAACGAGGACAGG + Intergenic
1147058713 17:37856144-37856166 GGTGGGAGGATCACGGGGACAGG - Intergenic
1148192133 17:45686683-45686705 GGTGAGAGGCTCACGAGGTCAGG + Intergenic
1151846624 17:76660413-76660435 GGTGAGATGCAAGTGGGGACAGG - Intergenic
1154454572 18:14509373-14509395 GGTGAGATGCTAGCAGGGGTGGG + Intronic
1162291781 19:9785852-9785874 GGAGAGATGGGAGCGGGGACTGG - Intronic
1162376671 19:10309302-10309324 GGTGAAGTGCTAGCGGGGTCCGG + Exonic
1165423498 19:35733407-35733429 GGGGAGGTGCTGGCGGGGACCGG - Exonic
928490572 2:31778592-31778614 GGTGGGGTGCTAACTGGCACAGG - Intergenic
929233674 2:39585366-39585388 GGAGAGACGCGAACGGGAACCGG + Intergenic
932794501 2:74682726-74682748 GGGGAGATGTCAAAGGGGACTGG + Intronic
934773803 2:96924526-96924548 GGTGAGATGCTTACGGTGAGGGG + Intronic
940464695 2:154013537-154013559 GGTGAGGTGCTGACAGGGGCGGG + Intronic
944847957 2:203687724-203687746 GATGAGATGCTGATGGGAACCGG + Intergenic
1174127195 20:48315426-48315448 GGAGAGATGCTCCCTGGGACAGG + Intergenic
1175311765 20:58017421-58017443 GGTGAAATGCTCAAAGGGACTGG + Intergenic
1176819596 21:13643935-13643957 GGTGAGATGCTAGCAGGGGTGGG - Intergenic
1179823951 21:43953292-43953314 GGTGAAATGGAAACAGGGACGGG + Intronic
1180907655 22:19426166-19426188 GGTGAGATGCTCAGGGAGACAGG - Intronic
1182914405 22:34015757-34015779 GGTGAGATGCTGAAGAGGACTGG + Intergenic
1183035193 22:35135742-35135764 GGTGAGATGCAAACAGGGTCGGG + Intergenic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
950121373 3:10484367-10484389 GGTGAGATTCTAGAAGGGACAGG + Intronic
951987137 3:28633139-28633161 GGTGATGTGCTAACGGAGAGAGG + Intergenic
957636974 3:82798979-82799001 GGTGAGATCATAACGGGGAATGG - Intergenic
961010631 3:123433375-123433397 GGTGAAATGCTTACGGGAAAGGG + Intronic
965483107 3:169244442-169244464 GCTGAGAAGCTGAGGGGGACAGG - Intronic
967436206 3:189449404-189449426 GGAGAGAAGCTAACTGGGAGAGG - Intergenic
967894206 3:194383691-194383713 GTAGGGATGCTCACGGGGACAGG + Intergenic
976816773 4:89157609-89157631 GGTGACATGTTTACGGAGACTGG - Intergenic
987710545 5:21497323-21497345 GGTGAGAAGGGAACGTGGACAGG - Intergenic
988801788 5:34702593-34702615 AGTGAGATGCTAATGTGAACGGG - Intronic
991760875 5:69916382-69916404 GGTGAGAAGGGAACGTGGACAGG - Intergenic
991786455 5:70201719-70201741 GGTGAGAAGGGAACGTGGACAGG + Intergenic
991840104 5:70791433-70791455 GGTGAGAAGGGAACGTGGACAGG - Intergenic
991878898 5:71202104-71202126 GGTGAGAAGGGAACGTGGACAGG + Intergenic
1003800127 6:9654691-9654713 GGTGAGAGGCTAAGGAGGATTGG + Intronic
1005547144 6:26883194-26883216 GGTGAGAAGGGAACGTGGACAGG + Intergenic
1009017906 6:57924268-57924290 GGTGAGAAGGGAACGTGGACAGG + Intergenic
1019576335 7:1739429-1739451 AGGGAGATGCCAGCGGGGACGGG + Intronic
1025035594 7:55591007-55591029 GGTGAGATGCGGCTGGGGACGGG + Intergenic
1028892949 7:96009327-96009349 CCTCAGATGCTAATGGGGACAGG - Intronic
1031375945 7:121026044-121026066 AGTGATCTCCTAACGGGGACGGG - Intronic
1040967767 8:53101476-53101498 GCTGAGATGCCACTGGGGACAGG + Intergenic
1042055161 8:64756634-64756656 TGTGAGATGCTAGCGGGCAGGGG - Intronic
1048443707 8:134478138-134478160 GGGAAGATGCTGAGGGGGACTGG + Exonic
1061753677 9:132798154-132798176 GGAGAGATGCTGACTGGGAAAGG - Intronic
1203527764 Un_GL000213v1:105635-105657 GGTGAGATGCTAGCAGGGGTGGG + Intergenic