ID: 1130994392

View in Genome Browser
Species Human (GRCh38)
Location 15:88895780-88895802
Sequence GGGGATCCCCTTAGAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130994378_1130994392 29 Left 1130994378 15:88895728-88895750 CCTCACGTCTTGGGAAAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1130994392 15:88895780-88895802 GGGGATCCCCTTAGAAAGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130994377_1130994392 30 Left 1130994377 15:88895727-88895749 CCCTCACGTCTTGGGAAAGGAGA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1130994392 15:88895780-88895802 GGGGATCCCCTTAGAAAGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130994392 Original CRISPR GGGGATCCCCTTAGAAAGCC TGG Intergenic
909739061 1:79006300-79006322 GGCAATCCCCTTAAAATGCCAGG + Intronic
913070929 1:115297918-115297940 GGTGATCCCAATATAAAGCCAGG + Intronic
917464814 1:175266847-175266869 GGGAATCCCCATTGATAGCCAGG - Intergenic
918120153 1:181531288-181531310 GGCTATCCCCCTAGGAAGCCAGG - Intronic
918577317 1:186078586-186078608 GGGGATCCCCTTGGATAGCAAGG + Intronic
919294129 1:195672267-195672289 TGGAATCCACTTAGAAAGCTTGG - Intergenic
920566321 1:206976354-206976376 GGGAATCTCCTTGGTAAGCCAGG - Intergenic
920691308 1:208148656-208148678 AAGGATCCCCTCAGGAAGCCCGG + Intronic
921055851 1:211541953-211541975 AGGGAAAGCCTTAGAAAGCCAGG + Intergenic
1065713011 10:28534161-28534183 GCGGATCCCCTTAAAATTCCAGG + Intronic
1072851180 10:98893844-98893866 GAGGATCCCTATATAAAGCCAGG + Intronic
1074086495 10:110211758-110211780 GGGGATTCCCTAGGAAAGGCAGG + Intronic
1076906804 10:133366638-133366660 GGGGAGCCCCACAGAAACCCAGG - Intronic
1076906844 10:133366776-133366798 GGGGAGCCCCACAGAAACCCGGG - Intronic
1085857313 11:80189736-80189758 TGGCATCCTCTTAGTAAGCCTGG - Intergenic
1086280996 11:85188269-85188291 GGGGTGACCCATAGAAAGCCAGG + Intronic
1090417950 11:126553723-126553745 GGGCATCCCATTAAAAGGCCAGG + Intronic
1095794658 12:46205109-46205131 GTAGCTCCCCTTAGAATGCCTGG + Intronic
1099865121 12:88270221-88270243 GGGGAAACCCTTATAAAACCAGG - Intergenic
1103293464 12:119866345-119866367 GGATAACCCCTAAGAAAGCCTGG + Intronic
1103377506 12:120468882-120468904 CGTGATCCCTTTACAAAGCCCGG + Intronic
1104530400 12:129564931-129564953 GGGGAGCCCCTGAGAAAGGAAGG + Intronic
1108046519 13:46388672-46388694 GGGAATCTTCTAAGAAAGCCAGG - Intronic
1119912971 14:78367954-78367976 GGGGATGCCTTTAAAAGGCCTGG + Intronic
1124271127 15:28281773-28281795 GGGGATGCCCTGAGAAGGGCAGG - Intronic
1125815944 15:42584308-42584330 GGGGAGCCCCGTTGAAAGTCTGG - Intronic
1126877725 15:53062184-53062206 GGGTATCTGCTTAGAAGGCCAGG - Intergenic
1127584997 15:60370037-60370059 GGAGATCCCCATAAAGAGCCTGG + Intronic
1128452298 15:67812555-67812577 GTGGAGCCCCTGAGACAGCCTGG + Intergenic
1130298349 15:82662811-82662833 GGGGATCCCCGGAGAAAGGTTGG + Exonic
1130994392 15:88895780-88895802 GGGGATCCCCTTAGAAAGCCTGG + Intergenic
1131521175 15:93116981-93117003 GGGGATCTCGTTAGAAATGCAGG + Intergenic
1133481554 16:6175702-6175724 GGGGAACCACTTAGAAATCCAGG - Intronic
1133985742 16:10666690-10666712 GTGGATCACCTTATGAAGCCAGG + Intronic
1135014621 16:18914759-18914781 TGGCATCCCATTAGAATGCCTGG - Intronic
1135747522 16:25029858-25029880 GGGGATACCCTTAAAACACCTGG - Intergenic
1136331782 16:29584074-29584096 TGGCATCCCATTAGAATGCCTGG - Intergenic
1136446418 16:30323816-30323838 TGGCATCCCATTAGAATGCCTGG - Intergenic
1138287672 16:55822570-55822592 GGGGCACCCTTTAGACAGCCAGG + Intronic
1138963919 16:62060581-62060603 GGGAATCTCCAGAGAAAGCCTGG + Intergenic
1141101736 16:81202532-81202554 GAGGATCCCCAAAGACAGCCTGG + Intergenic
1141443418 16:84043494-84043516 TGGGAACCCGTTAGAAAGGCAGG - Intergenic
1142680269 17:1543508-1543530 TGGGAACCCCTTAGAAAGCATGG + Intronic
1143961352 17:10723576-10723598 GGGGATCCACTTATAAATCAGGG - Intronic
1144210769 17:13013403-13013425 GGTAATCTCCTTAGAAAGTCTGG - Intronic
1144771422 17:17761749-17761771 GGGAATCCCCTGTGAATGCCAGG + Intronic
1145263325 17:21367505-21367527 GCTGTTCCCCTTAGAATGCCTGG + Intergenic
1148069502 17:44899778-44899800 GGGGATCCCCAAAGAAAGCAAGG + Exonic
1150442420 17:65202260-65202282 GGGGTTCCCTGAAGAAAGCCTGG + Intronic
1151330598 17:73404762-73404784 GGGGCTCCCCTGAGAAGGCTCGG + Intronic
1152684592 17:81687843-81687865 GGGGATCCCGGTGGACAGCCAGG + Intronic
1157816019 18:50729888-50729910 GGAGACCCCCAGAGAAAGCCGGG + Exonic
1160951041 19:1667567-1667589 GGGGCTCCCCTTACAGAGCCAGG - Intergenic
1163765382 19:19160782-19160804 GAAGAGCCCCTTGGAAAGCCAGG + Intronic
1164370059 19:27636310-27636332 GGCTATCCCATTAGAATGCCTGG + Intergenic
1164383147 19:27752318-27752340 GGGTATCTCATTAGAATGCCTGG + Intergenic
1168311569 19:55463499-55463521 GGGGATCCCCTGAGAATCCCAGG + Intergenic
928454310 2:31405381-31405403 GGGGGACTCCTTAGAAAGACTGG - Intronic
930772120 2:55139173-55139195 GGGGACCCCGTTTGATAGCCAGG + Intergenic
935695711 2:105769058-105769080 GGGGGTGCCCCTAGATAGCCTGG - Intronic
935850471 2:107213455-107213477 GGGGATTCTCAGAGAAAGCCTGG + Intergenic
936969307 2:118161592-118161614 GGAGAGCCCCAGAGAAAGCCTGG + Intergenic
944605501 2:201348407-201348429 AGGGATCCCCTAAGAAGGTCAGG - Intronic
1171011073 20:21509911-21509933 GGGGAGCGTCTTAGGAAGCCTGG - Intergenic
1173821932 20:46025303-46025325 GGAGATCTCCTTAGACAGACTGG - Intronic
1176909829 21:14551180-14551202 GGGAAGCCTCTTAGAGAGCCTGG + Intronic
1182392270 22:30008420-30008442 GGGCCTCTCCTTAGAAAACCTGG + Intronic
1183304980 22:37077977-37077999 GGGGCGCCCCTGAGCAAGCCTGG + Intronic
954687566 3:52378986-52379008 GGGGATCACATGAGAGAGCCAGG + Intronic
955060983 3:55491191-55491213 GGGGACTGCCTTAGAAAGCCAGG + Intergenic
959473474 3:106782101-106782123 CGGGATGCCATTAGAAAGCAGGG - Intergenic
961171336 3:124799854-124799876 AGGGGTCCCTTTAGTAAGCCAGG - Intronic
963079042 3:141374409-141374431 TGGGAGCCCCATAGAATGCCAGG - Intronic
968579409 4:1383013-1383035 GGGGAACCCCACAGGAAGCCTGG + Intronic
968669612 4:1842036-1842058 GGCGATCCCCACAGAAAGGCAGG + Intronic
975548804 4:75588946-75588968 GGGGATCCCACTAGAAAAACTGG + Intronic
985559372 5:574886-574908 GGGTATCCCCTTAAGAGGCCTGG + Intergenic
986708382 5:10470291-10470313 GGGGATCCCCTTCAATAACCAGG - Intronic
998352460 5:141510469-141510491 GAGGCTCCCTTGAGAAAGCCAGG + Intronic
1002352297 5:178591545-178591567 GGGGAACCCCTGAGATGGCCGGG + Intergenic
1002545558 5:179941447-179941469 GGGGATCCCAATGGAAGGCCTGG + Intronic
1002792180 6:444835-444857 GGGACTCCCCTTAGTAAGCTGGG - Intergenic
1006060390 6:31414503-31414525 GGGGACCCCATCAGGAAGCCTGG - Intronic
1006072833 6:31509275-31509297 GGGGACCCCATCAGGAAGCCTGG - Intronic
1007116180 6:39344952-39344974 GGGAATCTCCTTAGAAAGGGAGG + Intronic
1010356568 6:74940899-74940921 GGTGAACTTCTTAGAAAGCCAGG + Intergenic
1014913708 6:127120486-127120508 AGGGATCCCCTTGGGAAACCAGG - Intronic
1019075961 6:169388305-169388327 GGGAATTCCCTGAGAAGGCCTGG + Intergenic
1030606467 7:111643773-111643795 GGGGAGCCTCGGAGAAAGCCTGG - Intergenic
1031608038 7:123792966-123792988 TGGGATCCCCTGAAAAAGGCTGG - Intergenic
1034493500 7:151406971-151406993 GTGGATCCCCAAAGAAAGCAAGG - Intronic
1036054022 8:5230200-5230222 AGGGTCCACCTTAGAAAGCCAGG - Intergenic
1036431768 8:8698528-8698550 GGGTATCCACTTACACAGCCAGG + Intergenic
1037500995 8:19485440-19485462 AGGGATCCCCAGAGAAACCCTGG + Intronic
1039870951 8:41544798-41544820 TGGGAGCTCCTTAGAAAGGCAGG - Exonic
1048510816 8:135060582-135060604 GTGTTTCCCTTTAGAAAGCCTGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1057515105 9:95714173-95714195 GGGGAACCCCTGAGAAAGGAAGG + Intergenic
1059225718 9:112671123-112671145 TGGGATCCCCTGAGAAATACAGG - Intergenic
1059395903 9:114033892-114033914 GGGGACCCTCTGAGACAGCCAGG + Intronic
1185770220 X:2760290-2760312 GGGGATGCCATTGGACAGCCTGG - Intronic
1186410811 X:9342934-9342956 GGGGAGCCCTTGAGAAGGCCTGG + Intergenic
1187691948 X:21877567-21877589 GGGGAGCCCCAAAGTAAGCCTGG + Intronic
1187886119 X:23890387-23890409 GTGGATACCCTTAGCAAGCTGGG + Intronic
1188476540 X:30598486-30598508 GGCCATTCCCTTAGAAAGCAGGG + Intergenic
1189776598 X:44475404-44475426 GGTGAGCCCTTTAGAAAGCTGGG + Intergenic
1192672096 X:73155784-73155806 TGTGATCCACTCAGAAAGCCAGG + Intergenic
1197274169 X:124459000-124459022 GGCGTTGCTCTTAGAAAGCCTGG + Intronic