ID: 1130994960

View in Genome Browser
Species Human (GRCh38)
Location 15:88898596-88898618
Sequence GCTCAGGGAGGACCACAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130994951_1130994960 20 Left 1130994951 15:88898553-88898575 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130994960 Original CRISPR GCTCAGGGAGGACCACAGGT GGG Intergenic
900708587 1:4096097-4096119 GCTCAGGGTGGCCAAGAGGTCGG + Intergenic
901198950 1:7455981-7456003 CCTCAGGGATGACCAACGGTGGG - Intronic
902121794 1:14172654-14172676 GCACAGGGAGGAGCTCAGCTAGG + Intergenic
903119184 1:21203460-21203482 GAGCAGCTAGGACCACAGGTAGG - Intergenic
904090041 1:27938453-27938475 TCAAAGGCAGGACCACAGGTAGG - Intronic
904860885 1:33536906-33536928 ACTCAGGGAGGACAAGAGCTTGG - Intronic
905917424 1:41695413-41695435 TCTCATGGAGGACCATGGGTTGG + Intronic
906188806 1:43882146-43882168 GCTCAGGGAAGACCTCAGAGAGG + Intronic
907397157 1:54199153-54199175 GTTCAGGGAGGACCTCAGAAGGG - Intronic
907522322 1:55032242-55032264 GCTCATGGAGAACCTCTGGTAGG + Intergenic
908531875 1:65041488-65041510 GCACAGGTTGGAGCACAGGTGGG - Intergenic
908951392 1:69567403-69567425 GCTCAGGCAGGCGCACAGGCCGG + Intergenic
909392784 1:75135504-75135526 GGTCCGGGAGGCCCCCAGGTTGG + Intronic
912489438 1:110053810-110053832 CCTCAGGGAGGTCCACCCGTTGG - Exonic
912555413 1:110512630-110512652 GGTGAGGGAGGACAACCGGTGGG + Intergenic
915137429 1:153742936-153742958 GCCCAGGAAGGCTCACAGGTAGG - Intronic
915269491 1:154743420-154743442 GCTCAGAGAGGCCCCCAGGTTGG - Intronic
917170307 1:172165568-172165590 GGTCAGGGAGGAGCCCAGTTTGG - Intronic
918310057 1:183279401-183279423 GCTCAGGGTGGAGCACAGCGTGG + Intronic
918787083 1:188776276-188776298 CCTCATGGAGGACCACTGCTAGG + Intergenic
919942585 1:202298375-202298397 GCAGAGGGATGAGCACAGGTGGG + Intronic
921057230 1:211552189-211552211 GCTCAGAGAGGACCACTGAATGG + Intergenic
922758474 1:228109588-228109610 GCTGAGGGAGGACCCGGGGTGGG + Intergenic
923042631 1:230330663-230330685 GCTCAGTGAGCACTTCAGGTGGG - Intronic
924829164 1:247574201-247574223 GCTCAGGGAGGATCTCTGATGGG - Exonic
1070287449 10:75094314-75094336 CCTCGGGGAGGAGTACAGGTGGG - Intergenic
1070669543 10:78368398-78368420 CCTCTTGGAGGACCACAGGGGGG + Intergenic
1071504990 10:86226813-86226835 GCTCAGGGAGGACCGCCAGCTGG - Intronic
1072572968 10:96674693-96674715 CCTCAGGGAGGACCACTGTAAGG + Intronic
1075526321 10:123190131-123190153 TCTCAGCGTGGACCAGAGGTGGG + Intergenic
1076067237 10:127458559-127458581 CCTCAGGGAGGACCCCTGGAAGG - Intergenic
1076563922 10:131385711-131385733 GCTAAGGGAGGACTAGAGGGAGG + Intergenic
1076564035 10:131386249-131386271 GTTGAGGGAGGACCAGAGGGAGG + Intergenic
1076564119 10:131386606-131386628 GCTGAGGTAGGACCAGAGGGAGG + Intergenic
1076564187 10:131386911-131386933 GCTGAGGGAGGACCAGAGGCAGG + Intergenic
1076854007 10:133106408-133106430 TCCCAGGCAGGACCACAGCTTGG - Intronic
1077136320 11:1001100-1001122 CCTCAGGGGGAACCACAGGGTGG - Intronic
1077352996 11:2101381-2101403 CCTGAGGGAGGGGCACAGGTGGG - Intergenic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081613606 11:44577969-44577991 GCCCAGGGAGGGTCACAAGTTGG - Intronic
1081795129 11:45813475-45813497 GCTCAGAGAGGGCCCCAGGAAGG + Intergenic
1082701153 11:56433025-56433047 GCTGAGTGAGGCCCACATGTGGG - Intergenic
1082766386 11:57171360-57171382 GCTCAGGTAGGACTACAGTGAGG + Intergenic
1083922994 11:65790408-65790430 GCTCAGGGAGGCCAGCAGGCTGG + Intronic
1084169797 11:67395641-67395663 GCTCTCGGAGGACCTGAGGTGGG - Intronic
1084432222 11:69117485-69117507 GCTCAGGGCTGAGCACAGGATGG - Intergenic
1084543110 11:69799506-69799528 GCCCCGGGAGGCACACAGGTGGG + Intergenic
1086414668 11:86576699-86576721 GCTGAGGGAGGACTTCAGGCTGG - Intronic
1087022867 11:93620933-93620955 GGTCAGGGAAGACCTGAGGTGGG + Intergenic
1087442752 11:98207507-98207529 GCTCAGGGAGCCCCACAGTCTGG + Intergenic
1089341869 11:117763583-117763605 GCTCAGGATGCATCACAGGTGGG - Intronic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1089883927 11:121801208-121801230 ACTCAGTGAGGAAGACAGGTGGG + Intergenic
1090383344 11:126342296-126342318 GCTCAGGAAGGACAGCAGGAAGG + Intronic
1090386750 11:126361699-126361721 GCTCAGGCTGAACCAAAGGTAGG + Intronic
1091190816 11:133694000-133694022 GCTCGGGGAGGACAGCAGTTGGG - Intergenic
1091403836 12:196806-196828 GAACAGGCAGGACCACAGCTGGG + Exonic
1091683953 12:2548299-2548321 GCTCTGGGAGCACCACAGGAGGG - Intronic
1092177830 12:6423014-6423036 CCTAAGGGAGGGCCACTGGTGGG - Intergenic
1092263963 12:6967389-6967411 CTGCAGGGAGGCCCACAGGTGGG - Intronic
1094583330 12:31754785-31754807 GCTCAAGGAGGAGCACAAGGTGG + Intergenic
1095946700 12:47757999-47758021 GCTCTGGGAGCACCGCGGGTGGG - Exonic
1096070746 12:48774224-48774246 ACTCAGGGATGACAAGAGGTTGG + Intronic
1096583871 12:52606808-52606830 GCCCAGGGAGGAACTCAGGGGGG - Intergenic
1099245353 12:80187362-80187384 GCTCAGGTATGGCCACAGATTGG - Intergenic
1099493464 12:83315239-83315261 CCTCAGTGAGGAACACAAGTAGG + Intergenic
1101851122 12:108403253-108403275 CCTCAGGGAGCAGCAGAGGTAGG + Intergenic
1102229979 12:111255934-111255956 ACTCAGGGAGACCCACATGTGGG - Intronic
1103818161 12:123675496-123675518 GCACCAGGAGGACCACAGTTAGG - Intronic
1108521842 13:51253006-51253028 TCTCAGGTAGGACCAGATGTAGG - Intronic
1109178933 13:59189797-59189819 GCTAATGGAAGACCCCAGGTAGG - Intergenic
1112031092 13:95457411-95457433 ACTCAGGGAGGACCAAAGCAAGG + Intronic
1113269302 13:108655481-108655503 CCTCATGGAGGACCTCAGCTAGG + Intronic
1113783495 13:112989546-112989568 GCTCAGGGAGGACTCCAGTGTGG - Intronic
1113807571 13:113118534-113118556 GGTCAGTGAGGACCACGGGCTGG - Exonic
1118816959 14:69320672-69320694 CATCAGAGAGGACCACAGGCAGG - Intronic
1120190747 14:81436975-81436997 GCTCAGGTAGGACCACTGAGAGG - Intergenic
1121124697 14:91398721-91398743 GGACAGGGAGCACCACAGGCTGG + Intronic
1121126297 14:91408924-91408946 GCTAAGCCAGGACCTCAGGTGGG + Intronic
1121733462 14:96202347-96202369 GTTCAGCAAGGACCACAGGAGGG - Intergenic
1122936047 14:104956734-104956756 GGACAGGGAGGGGCACAGGTAGG + Intronic
1124151006 15:27178097-27178119 GCACAGGGATGTGCACAGGTGGG + Intronic
1127559785 15:60124593-60124615 GCTCAGTGGGGACAGCAGGTTGG + Intergenic
1128034128 15:64508270-64508292 GCTCAAGGAGGCCCAAAGGAAGG + Intronic
1128073600 15:64812480-64812502 CCTCTGGGAGCACCACAGGGAGG + Intergenic
1128225012 15:65995317-65995339 GCTCAGTGAGGACCATATGATGG - Intronic
1128716825 15:69914588-69914610 GCTCAGTGAGGCCCACTGGGAGG + Intergenic
1129318249 15:74759242-74759264 ACTCAGGGAGAGACACAGGTAGG - Intergenic
1130049622 15:80472992-80473014 GCTGAGAGAGGAACAAAGGTAGG - Intronic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1131116984 15:89801836-89801858 CCTCAGGGTGGACCACAGAATGG - Intronic
1132194081 15:99897145-99897167 GCTCATGGAGAACCTCAGCTAGG - Intergenic
1132462359 16:61793-61815 GGACATGGACGACCACAGGTAGG - Exonic
1132501997 16:288588-288610 GCTGAGGGAGGGCCCCAGTTGGG - Intronic
1132583523 16:695834-695856 GCTCAGGCTGGACCACAGCCCGG + Exonic
1133975102 16:10594965-10594987 GCTCAGGGAAGATCACTGCTGGG + Intergenic
1136590812 16:31216629-31216651 TCTGAGGGAGGACCCCAGGAGGG + Intronic
1137293142 16:47065890-47065912 GCTTAGGGAGGCCCAGAGCTGGG + Intergenic
1141363442 16:83419103-83419125 TGTCAGGGAGGACAACAGTTAGG - Intronic
1141982955 16:87561138-87561160 GCTAAGGGAGGTCCAGAGGGTGG + Intergenic
1141990336 16:87605677-87605699 GATCAGGCAGGACCACAAGGAGG - Intronic
1142504558 17:354590-354612 CCCCTGGCAGGACCACAGGTCGG + Intronic
1142967747 17:3591733-3591755 GGGCAGGGAGGGCCACAGGCTGG - Intronic
1143858931 17:9873651-9873673 GCTCAGGGAAGCCAAAAGGTTGG + Intronic
1146908121 17:36630846-36630868 GCTCAGTGAGAACCTCATGTGGG + Intergenic
1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG + Intronic
1147739770 17:42664708-42664730 GCTCTGGGAAGACCACAGAGAGG - Intronic
1147962469 17:44176612-44176634 TCTCATGGAGGACACCAGGTAGG + Intronic
1149004935 17:51795726-51795748 GCTCAGGGCTGACCCCAGGGAGG + Intronic
1149579602 17:57740279-57740301 GCTCAGGGAGGAGCATGGCTAGG - Intergenic
1149664317 17:58355067-58355089 GCTGAGAGGGGACCACAGGGAGG + Intronic
1151356435 17:73561275-73561297 GCTGAGGGCTGACCGCAGGTGGG - Intronic
1152199346 17:78936032-78936054 GCGCTGGGAGGCCCACAGGCCGG + Intergenic
1152784081 17:82239057-82239079 GCTCAGGCAGGGCCACGGCTGGG + Exonic
1153795442 18:8617738-8617760 GCACAGGGAGGAGCACAGCCGGG + Intronic
1153929102 18:9862930-9862952 ACTCAGCCAGGGCCACAGGTTGG - Intergenic
1154129883 18:11727469-11727491 GAACAGCTAGGACCACAGGTGGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161318759 19:3631517-3631539 ACGCAGGGAGGACCCCACGTGGG + Exonic
1162399394 19:10435764-10435786 GCTCAGGGTGGCCCAAAGTTAGG - Intronic
1163138902 19:15332867-15332889 CCTAAGGGGGGACCCCAGGTAGG + Intergenic
1163726878 19:18928102-18928124 GCACAGGGAGGACCAGGGGATGG - Intronic
1164761762 19:30733450-30733472 TCCCAGGGAGGAGCAAAGGTGGG - Intergenic
1167873330 19:52391220-52391242 GCACAGGGAGAACCACAGCCTGG + Intergenic
1168210738 19:54888247-54888269 ACTGGGGAAGGACCACAGGTAGG - Exonic
1168457876 19:56527961-56527983 GCCCAGGGAAGACAAAAGGTTGG - Exonic
1168650917 19:58091589-58091611 GCTGAGGGTGGGGCACAGGTTGG - Intronic
925210990 2:2045880-2045902 ACCCATGGAGGACCACAGGGAGG - Intronic
927423441 2:22956095-22956117 GCTTTGGGAGGACCAGAGGAGGG - Intergenic
932432648 2:71685152-71685174 GATGAGGAAGGACCACAGGCTGG - Intronic
934852001 2:97707472-97707494 GCTCTGGGAGGGCCACATGGTGG - Intergenic
935315600 2:101830736-101830758 GCTCAGGGACTATCACAGGCTGG - Intronic
936927552 2:117753011-117753033 GCTCAAGGAGCAACACAGGTTGG - Intergenic
938711111 2:133977072-133977094 TCTCAATGAGGACCACAGGCAGG + Intergenic
939032645 2:137094938-137094960 GCTCCAGGAGGACCACTGGGAGG - Exonic
942226568 2:173821840-173821862 CCTCAGGGGAGACCACAGATGGG + Intergenic
943575271 2:189624722-189624744 TCTCAGAGGTGACCACAGGTTGG + Intergenic
944661682 2:201926597-201926619 GTTCAAGGAAGACCACAGCTGGG + Intergenic
945399279 2:209360011-209360033 CCTCAAGGAGGATCACAGTTGGG - Intergenic
948753440 2:240145200-240145222 GCTCAGCGAGGACAGCAGGGTGG - Intergenic
948886414 2:240887328-240887350 GCTCAGGGAGCAGCAGAGGCTGG - Intronic
1170704821 20:18736022-18736044 GCTCAGGGAAGCCAAAAGGTTGG + Intronic
1175693464 20:61083212-61083234 GCTCATGGAGGACAACAGGGAGG - Intergenic
1175728285 20:61334137-61334159 GCTCAGGGAGGCCCTCAGAGGGG - Intronic
1175807604 20:61838413-61838435 GCTCAAGCAGGAGCACTGGTTGG + Intronic
1175942831 20:62545886-62545908 GCTCAGGGAGGACCCCGGGCAGG - Intergenic
1176070276 20:63222610-63222632 GCCTGGGGAGGGCCACAGGTGGG + Intergenic
1176141870 20:63548434-63548456 GCTCAGGTAGGTCCCCAGATCGG + Intronic
1176457553 21:6927748-6927770 GCACAGGGAGGAGCGGAGGTAGG + Intergenic
1177702753 21:24659754-24659776 ACTTAGGGAGGAACACAGTTGGG + Intergenic
1178050135 21:28737922-28737944 GTTCAGGGAGAAACACAGGAAGG + Intergenic
1178909169 21:36660396-36660418 GATCAGGAAGGAGCACAGCTGGG - Intergenic
1179329386 21:40384149-40384171 GTTCAGGGAGGCCCACAGGTTGG + Intronic
1179567926 21:42260753-42260775 GCTCATGGGGGAACAGAGGTGGG - Intronic
1181452899 22:23035815-23035837 GTTCAGGGAGGACCGCAGAAGGG + Intergenic
1181544174 22:23591695-23591717 GCTCAGGGAAAATCACAGCTGGG + Intergenic
1181585159 22:23849161-23849183 GCTCAGAGAGGCCAACAGGCTGG + Intergenic
1182082060 22:27536562-27536584 GCTGAGGGAGGACGACGGCTGGG - Intergenic
1182761822 22:32728616-32728638 TCTCAGGGAGCACAAGAGGTTGG + Intronic
1183785015 22:40024239-40024261 GCTTTGGGAGGCCCAGAGGTAGG - Intronic
1184059873 22:42075025-42075047 GCTCAGAGAGGCCCTCAGGAGGG - Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
1184162253 22:42703940-42703962 GCCCAGGGAGGGGCAGAGGTGGG - Intronic
1184591044 22:45483474-45483496 GGTCAGGGAGGGCTCCAGGTGGG + Intergenic
1184694469 22:46131815-46131837 GCTCAGGGAGAAACACAGGAGGG + Intergenic
1184765341 22:46569298-46569320 GATCAGGGAGACCCACAGGAGGG + Intergenic
1184865523 22:47199841-47199863 TCTCACGGAGGCCCCCAGGTGGG - Intergenic
1185071606 22:48659663-48659685 GCTCAGAGAGGACAGCAGCTGGG - Intronic
951015863 3:17731989-17732011 GTTCAGGGAGGAAATCAGGTTGG + Intronic
953141577 3:40234187-40234209 TCTCAGGAAGGACCTTAGGTTGG + Intronic
953357021 3:42264760-42264782 GTTCAGGGAGGACCAGCGGGCGG + Exonic
953932235 3:47011220-47011242 GCTCAGGATGGAAGACAGGTTGG - Intergenic
954601911 3:51876763-51876785 GCTCAGGGTGGAGCAGAGCTGGG - Intergenic
954713345 3:52515568-52515590 GCCCAGGGAGGAGCCCAGTTTGG + Intronic
956608840 3:71101274-71101296 GCTAAGAGAGAACCACAGGTAGG + Intronic
956897846 3:73682127-73682149 GCTCAGGGAGGCCAAAAGATTGG + Intergenic
962407014 3:135109117-135109139 CCTCAGGGAGCACTACAGGGAGG - Intronic
965751301 3:171977407-171977429 TCTCAGTGAGGAACACTGGTAGG + Intergenic
965834126 3:172832109-172832131 GGTCAGGGAGGAGCACAGAGCGG + Intergenic
966083429 3:176035575-176035597 GCTGAGGGATGAGAACAGGTAGG - Intergenic
967302361 3:188027432-188027454 GATCAGGGAGGACCAGAGAAAGG - Intergenic
968266197 3:197365257-197365279 GCACATGGAGGAACACAGATTGG - Intergenic
968446517 4:655015-655037 GCACACAGAGCACCACAGGTGGG - Intronic
968551573 4:1226213-1226235 GCTCAGGGAGGGGCACTGGCTGG - Intronic
968910994 4:3476965-3476987 GCTCTGGGCGGCCCACAGGCGGG - Intronic
972644226 4:40952942-40952964 GCTCAGAGAGGACAGCAGATGGG + Intronic
975588638 4:75978025-75978047 ACTGAGGGAGGGCCACAGGGAGG + Intronic
975740549 4:77425249-77425271 GCGCATGGATGACCAAAGGTTGG - Intronic
976281766 4:83333456-83333478 GCTCAGGGAGGACAGCATCTAGG + Intronic
978611458 4:110545640-110545662 GTTCAGAGAGGACCAAAAGTAGG - Intronic
980320665 4:131268865-131268887 GCCCAGGGAGGCCAACAGATTGG - Intergenic
985485472 5:146133-146155 GAGGAGGGAGGACCACAGGTTGG - Intronic
985841116 5:2306606-2306628 GTTCAGGGAGGCCCAGAGCTTGG + Intergenic
992751389 5:79865869-79865891 GCTGAGTCAGGACCTCAGGTGGG - Intergenic
992833559 5:80618659-80618681 GTGCATGGAGGACCACATGTGGG - Intergenic
993984057 5:94575610-94575632 GCTCAGGGAGAACCATACTTTGG - Intronic
998508814 5:142694614-142694636 CCTGAGGGAGGACCCCAGCTTGG + Intronic
998509213 5:142697504-142697526 GATCAGGGAGGAGAACAGGAAGG + Intronic
998588259 5:143450809-143450831 GCTCAGTGAAGATGACAGGTGGG - Intergenic
999200732 5:149814474-149814496 GGTCAGTGAGGACCAGAGGGGGG + Intronic
1002261458 5:177996358-177996380 GCTCAGGGAGGATCACAAGCCGG + Intergenic
1005215798 6:23526798-23526820 GCTCAGGGAGGTTCACTCGTGGG - Intergenic
1005359554 6:25017978-25018000 ACTGAGGGATGACAACAGGTAGG + Intronic
1007066652 6:38997356-38997378 GCTGGGTGAGGACCAGAGGTGGG - Intronic
1013157543 6:107507695-107507717 GCCCAGGGAAGCCCAAAGGTTGG + Intronic
1013607380 6:111762712-111762734 GCCCAGGGAAGACAAAAGGTTGG - Intronic
1016890653 6:149003837-149003859 CCTCAGGAAGGCACACAGGTGGG - Intronic
1017013792 6:150083778-150083800 GTCCAGGGAGGAGCACAGGAGGG + Intergenic
1017665753 6:156719141-156719163 GCTCCGCAAGGATCACAGGTGGG + Intergenic
1018354555 6:162999297-162999319 ACTCAGTGAGGACCAGAGCTAGG - Intronic
1018823943 6:167395326-167395348 GCTCACAGAGGACCTCATGTGGG - Intergenic
1018986144 6:168638571-168638593 GCTCAGAGAGGAGCTCAGCTGGG + Intronic
1019424123 7:965458-965480 CCTCAGGGACGCCCCCAGGTCGG + Intronic
1019744515 7:2692183-2692205 GCTCCTGGAGGAAGACAGGTGGG + Intronic
1019918314 7:4147555-4147577 GCTATGGGAGGACCAAAGGCAGG - Intronic
1021415076 7:20374682-20374704 GCAGAGGAAGGACCACAGGCAGG + Intronic
1023830288 7:44035161-44035183 GGTCAGGGAGGACCTCTGATGGG - Intergenic
1027051738 7:75025249-75025271 GCTCAGACAGGAACCCAGGTGGG + Intergenic
1027977017 7:85171495-85171517 GCCCAGGAATGAACACAGGTAGG - Intronic
1028061334 7:86321098-86321120 TCTGAGGGAGGACAACAGGCTGG + Intergenic
1028504807 7:91559166-91559188 TCTCAGGCAGCACCACAGGGAGG + Intergenic
1028823639 7:95243643-95243665 GTTAAGGGAGGAACAGAGGTAGG + Intronic
1029740606 7:102489448-102489470 GGTCAGGGAGGACCTCTGATGGG - Intronic
1029758603 7:102588620-102588642 GGTCAGGGAGGACCTCTGATGGG - Intronic
1029776541 7:102687699-102687721 GGTCAGGGAGGACCTCTGATGGG - Intergenic
1031393870 7:121248312-121248334 GTTCAGGGAGCCCCACAGCTTGG + Intronic
1032017405 7:128388856-128388878 GCTCAGGAGGGAAAACAGGTGGG - Intergenic
1032524026 7:132565700-132565722 GCTTTGGGAGGAAGACAGGTGGG - Intronic
1034758862 7:153651972-153651994 GCTGAGGAACGACCACAGATTGG + Intergenic
1036806488 8:11837889-11837911 GCACAGGGAGGACTCCAGGGTGG + Intronic
1037293866 8:17380477-17380499 GCTCAGGGAAGCCGAAAGGTTGG - Intronic
1042097276 8:65230660-65230682 GCCCAGGGAGAAGCACAGCTTGG - Intergenic
1043324632 8:79034487-79034509 GCTCTCCAAGGACCACAGGTTGG - Intergenic
1044934783 8:97283085-97283107 GCTAAGAGAGGTCCAGAGGTTGG + Intergenic
1047715537 8:127591644-127591666 CCTCAGGGAGGAGGGCAGGTGGG + Intergenic
1048262468 8:132956715-132956737 GCTCCTGCAGGACCAAAGGTAGG + Intronic
1048486877 8:134856579-134856601 CCTCAAGGAGGAACAGAGGTAGG - Intergenic
1048533612 8:135273012-135273034 CCACAGGCAGGTCCACAGGTGGG - Intergenic
1048857673 8:138698126-138698148 GCTCAGGGTGGACCTGAGGGAGG + Intronic
1049029468 8:140023656-140023678 GCACAGTGAGAACCACACGTAGG + Intronic
1049065123 8:140307332-140307354 GTTCAGGGAGGAATTCAGGTAGG - Intronic
1049141598 8:140960054-140960076 TCTCAGGGATAACCACAGGTAGG - Intronic
1049255636 8:141612227-141612249 GCCCAGACAGGGCCACAGGTTGG - Intergenic
1049267137 8:141674189-141674211 GCAGAGGGTCGACCACAGGTGGG + Intergenic
1049537370 8:143188649-143188671 GCTAAGGCAGGACCTCAGGATGG + Intergenic
1050141806 9:2523849-2523871 GCTGAGGGAGAGGCACAGGTGGG - Intergenic
1051013545 9:12448102-12448124 GCTCATGGAGGACCTCTGCTAGG + Intergenic
1051261994 9:15273644-15273666 CCTCAATGAAGACCACAGGTGGG + Intronic
1051683156 9:19628733-19628755 GCTCAGGGAAGCCAAAAGGTTGG - Intronic
1052851557 9:33381380-33381402 GCTCAGGGAGGGACAGAGGAGGG + Intergenic
1055843265 9:80531412-80531434 CCTCATGGAGAACCACTGGTAGG - Intergenic
1058526694 9:105866259-105866281 ATTCAGGGATGATCACAGGTGGG - Intergenic
1060588727 9:124802680-124802702 GGTCGAGGAGGACCACAGGGAGG - Intronic
1060913463 9:127369552-127369574 GCTCTGGCAGGGGCACAGGTGGG - Intronic
1062180421 9:135188444-135188466 TCTCAGGCAGGGCCACAGTTGGG + Intergenic
1186469153 X:9807774-9807796 TCTCAGGGAGGATCACAGAAGGG - Intronic
1187338169 X:18398753-18398775 GCTCAGGATGGAGAACAGGTGGG + Intergenic
1189905385 X:45753944-45753966 GCTCAGGGAGGACAAGAGAATGG + Intergenic
1190111292 X:47590647-47590669 GCTCAGGGAGGAGCCCAGAAAGG + Intronic
1192236839 X:69301535-69301557 GCTCGCAGAGGACCACAGGTGGG - Intergenic
1192680448 X:73248289-73248311 GCTCATGGAGGACCTCTGCTAGG + Intergenic
1198935851 X:141902723-141902745 TCCCAGGGATGACAACAGGTGGG - Intergenic
1199203838 X:145124451-145124473 CCTCATGGAGAACCACTGGTAGG - Intergenic
1199569368 X:149252282-149252304 GCTCATGGAGAACCTCAGCTAGG - Intergenic
1199875049 X:151922245-151922267 GCTCAGGGGGGACCAGAGGAGGG + Intronic