ID: 1130995534

View in Genome Browser
Species Human (GRCh38)
Location 15:88901769-88901791
Sequence GATCCACAGCTCCCAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 455}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130995527_1130995534 7 Left 1130995527 15:88901739-88901761 CCAGCAAGGTGGGCTGTCATCTG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG 0: 1
1: 1
2: 1
3: 34
4: 455
1130995526_1130995534 11 Left 1130995526 15:88901735-88901757 CCTGCCAGCAAGGTGGGCTGTCA 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG 0: 1
1: 1
2: 1
3: 34
4: 455
1130995522_1130995534 28 Left 1130995522 15:88901718-88901740 CCAGGGGATTGGCGCATCCTGCC 0: 1
1: 0
2: 5
3: 13
4: 115
Right 1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG 0: 1
1: 1
2: 1
3: 34
4: 455
1130995521_1130995534 29 Left 1130995521 15:88901717-88901739 CCCAGGGGATTGGCGCATCCTGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG 0: 1
1: 1
2: 1
3: 34
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130995534 Original CRISPR GATCCACAGCTCCCAGGGGC AGG Intronic
900226028 1:1534084-1534106 GATCCACAGCTCACGGAGCCTGG + Exonic
900474403 1:2869467-2869489 GGTCCCCAGCTCCCAGAGCCTGG + Intergenic
901588313 1:10317008-10317030 GCTCCAGGGATCCCAGGGGCTGG + Intronic
901677974 1:10897990-10898012 GATTCACAGGTCTCAGGGTCAGG - Intergenic
901748938 1:11394040-11394062 CATCCACAGGACCCAGGGTCTGG - Intergenic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
903351141 1:22717219-22717241 TTTGCACAGCTCCCAGGGGTGGG + Intronic
903374321 1:22856292-22856314 TATCCCCAGAGCCCAGGGGCAGG + Intronic
903451244 1:23455213-23455235 GATGCACAGCTCTGTGGGGCTGG - Intronic
904088894 1:27930695-27930717 GCTACACAGTTCCTAGGGGCTGG + Intergenic
904958953 1:34315786-34315808 GGTCCACAGATCCCTAGGGCAGG - Intergenic
905352581 1:37357715-37357737 GAAGCAGAGTTCCCAGGGGCTGG + Intergenic
905524133 1:38623775-38623797 GATCCACACCTCCAGAGGGCAGG - Intergenic
905744847 1:40406394-40406416 GATTCATAGTTGCCAGGGGCTGG + Intronic
905876898 1:41437447-41437469 GATTCAAAACTCCCAGGAGCTGG + Intergenic
906125825 1:43426429-43426451 GCTGCACAGCTGCCTGGGGCAGG + Intronic
906353816 1:45085658-45085680 GTTCCACAGATCCCAAGGGCAGG + Intronic
906371617 1:45258690-45258712 GAACAACTGCTCTCAGGGGCTGG - Intronic
907241583 1:53084108-53084130 CTTCCCCAGCTCCCAGGGCCCGG + Intronic
907458998 1:54594161-54594183 AATCCACAGCTCCCTGAGGAAGG + Intronic
908715659 1:67067259-67067281 GTTCCACAGATCTCTGGGGCAGG - Intergenic
908963594 1:69730435-69730457 GTTCCACAGATCTCAAGGGCAGG + Intronic
909269253 1:73601558-73601580 GTTCCACAGATCTCTGGGGCAGG + Intergenic
909503675 1:76363288-76363310 GTTCCACAGATCCCTGGAGCAGG + Intronic
912192229 1:107353371-107353393 GTTCCACAGATCCCTAGGGCAGG + Intronic
912405088 1:109430928-109430950 GATACACAGACACCAGGGGCAGG + Intergenic
915083487 1:153368081-153368103 GATCCACAGAGCCCAGGGATTGG - Intergenic
915282041 1:154829410-154829432 TTACCACAGGTCCCAGGGGCTGG + Intronic
915535792 1:156534601-156534623 GAGCCACAGCCCCCAGGGCATGG + Exonic
915694221 1:157722563-157722585 GTTCCACAGATCCCTAGGGCAGG + Intergenic
916649385 1:166820623-166820645 GTTCCACAGATCCCCAGGGCAGG + Intergenic
916650466 1:166830261-166830283 GTTCCACAGATCTCTGGGGCAGG - Intergenic
916713718 1:167433184-167433206 GATCCTTCTCTCCCAGGGGCAGG - Intronic
919974800 1:202603413-202603435 GCTCCATAGCTTCTAGGGGCTGG + Intronic
920209153 1:204315493-204315515 AATCCAAATCTCCCAGGGGAAGG + Intronic
920251421 1:204624758-204624780 GACCCTCAGCTCCCGGGGGGGGG - Intronic
921013915 1:211169646-211169668 GTTCCACAGATCCCTAGGGCAGG + Intergenic
921478442 1:215636628-215636650 GCTCCACAGCACGCAGGGGAAGG + Intronic
921955634 1:220980693-220980715 GATCCACAGCTTCCAGAGGGAGG + Intergenic
922203734 1:223429013-223429035 GAACCATAGCTTCCAGGAGCTGG + Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923286069 1:232497138-232497160 GAGCCATGGCTGCCAGGGGCTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924251853 1:242140886-242140908 GAGCCACAGCTCACAGGTGATGG + Intronic
1063389530 10:5640274-5640296 GATGCACAGGCCCCAGGTGCAGG - Exonic
1063949984 10:11213223-11213245 CATCTACAACACCCAGGGGCTGG - Intronic
1064397933 10:14996212-14996234 GATCCACATCGCCGAGGGGCGGG - Intergenic
1064596859 10:16954007-16954029 AAACCACTGCTTCCAGGGGCTGG + Intronic
1067829913 10:49605660-49605682 TCTCTACAGCTCCCAGGGACAGG - Intergenic
1068300917 10:55137877-55137899 GATCCAAAGCTACTGGGGGCAGG + Intronic
1068604412 10:58989711-58989733 GTTCCACAGATCTCAGGAGCAGG - Intergenic
1068610382 10:59053611-59053633 GATTCACAGCTCCATGTGGCTGG + Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069359534 10:67625834-67625856 GATTTACATCTCCAAGGGGCTGG - Intronic
1069708572 10:70474834-70474856 GATGCTCAGGTCCCAGGGCCTGG + Intergenic
1069712628 10:70499718-70499740 GAGCCACAGCTGGCAGGTGCAGG + Intronic
1069751218 10:70746398-70746420 GATCCGTGGCTGCCAGGGGCTGG + Intronic
1071566523 10:86674075-86674097 GATCCACAGCTGGCAGAGGGTGG - Intronic
1073382526 10:103090487-103090509 GATGTACAGAGCCCAGGGGCAGG - Intronic
1074069066 10:110048633-110048655 GTTCCACAGATCTCTGGGGCAGG - Intronic
1074406746 10:113186346-113186368 GATCAATGGCTGCCAGGGGCTGG - Intergenic
1075070074 10:119314607-119314629 GGTCCACTGTTCCCTGGGGCAGG - Intronic
1075288679 10:121209436-121209458 GATACAGACCTCCCGGGGGCAGG + Intergenic
1075456545 10:122588635-122588657 GCTCCACAGCTCCAGAGGGCAGG - Intronic
1075621257 10:123929805-123929827 GATCCAGAGCTGGCAGGGGCGGG - Intronic
1076334159 10:129693945-129693967 TTTCCACAGTTCCCATGGGCAGG + Intronic
1076381792 10:130028576-130028598 CATCCACAAGTCCCAGAGGCTGG + Intergenic
1076502528 10:130948554-130948576 GATCAAGAGCTCTCAGGGGTGGG + Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1077321436 11:1944290-1944312 GAGCCAGGGCTGCCAGGGGCCGG + Intergenic
1077336309 11:2006378-2006400 GATCGCCAGCTCCCAGGGTCAGG - Intergenic
1077341769 11:2029400-2029422 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1077386872 11:2273579-2273601 GATTCACGGTTGCCAGGGGCTGG + Intergenic
1077414196 11:2417030-2417052 GATCGATGGTTCCCAGGGGCTGG + Intronic
1078251181 11:9617724-9617746 GAGCCACAGCGCCCTGGGGACGG + Intergenic
1078620892 11:12906700-12906722 GATCCACAGTTGCCTGGGGCTGG - Intronic
1079729420 11:23921400-23921422 CAGCCACAGCTGCCAGGGGTGGG + Intergenic
1081565588 11:44259011-44259033 GAGGCACAGGTCCCAGGGGTGGG + Intergenic
1081815009 11:45934159-45934181 GATGCACAGCTCCCTGGAGAAGG - Exonic
1082267168 11:50131617-50131639 GATATTCAGTTCCCAGGGGCAGG + Intergenic
1082288921 11:50346951-50346973 GATATTCAGTTCCCAGGGGCAGG - Intergenic
1082714773 11:56598874-56598896 GATCTCCAGTTCACAGGGGCAGG - Intergenic
1083662214 11:64256673-64256695 GATCCAGGGCTTCCAGGGGCAGG - Exonic
1083714290 11:64567020-64567042 GCTCCCACGCTCCCAGGGGCTGG - Intronic
1083990632 11:66243851-66243873 ACTTCACAGCTCACAGGGGCAGG + Exonic
1084524359 11:69686635-69686657 GAGACACAGCTCCTAGGGGCAGG + Intergenic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1087362674 11:97180274-97180296 GATTCACAGTTCCAAGTGGCTGG - Intergenic
1088878976 11:113958828-113958850 CCTCCACAGCTCCCTGGGGTGGG - Intergenic
1089318392 11:117607601-117607623 GATCCACAGCTCCCCAGTGAAGG + Intronic
1089576156 11:119445646-119445668 AATTTACAGATCCCAGGGGCTGG - Intergenic
1089628707 11:119770141-119770163 TATGCACAGTTCCCAGGGCCCGG - Intergenic
1202819293 11_KI270721v1_random:61560-61582 GATCGCCAGCTCCCAGGGTCAGG - Intergenic
1202824755 11_KI270721v1_random:84589-84611 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1091405419 12:206250-206272 GAATCACACCTACCAGGGGCTGG - Intronic
1093014863 12:14145495-14145517 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1095226797 12:39686929-39686951 GTTCCACAGATCCCTAGGGCAGG + Intronic
1097084020 12:56454316-56454338 CAGCCACAGCTCCCAGGAGCTGG + Exonic
1097474316 12:60034614-60034636 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1097593821 12:61603315-61603337 GATCCCCAGTTCTCAGGGACTGG + Intergenic
1097682175 12:62659051-62659073 GATCCACAGCGTCAAGGAGCCGG + Intronic
1101592787 12:106138868-106138890 GCTCCACAGCTCGCCGCGGCCGG - Exonic
1101664389 12:106797468-106797490 GATTCATAGTTGCCAGGGGCTGG + Intronic
1102080219 12:110091721-110091743 CATCCACAAGTCCCAGGGGTGGG + Intergenic
1103259110 12:119570693-119570715 GATTCACAGTTCCGAGTGGCTGG + Intergenic
1103956729 12:124581622-124581644 GATTCACGGCTACCAGCGGCTGG + Intergenic
1104458887 12:128937860-128937882 GACTCACAGCTCCAAAGGGCTGG - Intronic
1104882329 12:132081197-132081219 GATTGAAAGCTCCCAGGGTCTGG + Intergenic
1104945908 12:132414826-132414848 GCTCCACAGCTCCCTGGGGTGGG - Intergenic
1106619056 13:31356337-31356359 GACTCACAGTTCCAAGGGGCTGG - Intergenic
1107016740 13:35713682-35713704 GATCGACGGTTGCCAGGGGCTGG + Intergenic
1109128026 13:58543086-58543108 GATCCACAGCTCCTGGTGGGTGG + Intergenic
1109840790 13:67914667-67914689 GATCCACATCTCAGGGGGGCGGG + Intergenic
1109857906 13:68156985-68157007 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1111015928 13:82381930-82381952 GATTCACAGTTCCAAGGAGCTGG - Intergenic
1111222222 13:85220093-85220115 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1112626186 13:101106772-101106794 GATTCACAGTTCCAAGTGGCTGG - Intronic
1113607708 13:111622252-111622274 GCCCCGCAGGTCCCAGGGGCTGG - Intronic
1113681096 13:112245647-112245669 GATCCAGAGCTCACAGGTCCAGG - Intergenic
1113891103 13:113736005-113736027 GGTCCACATCTGCCAGGCGCAGG + Exonic
1114604067 14:23981970-23981992 GACACTCAGTTCCCAGGGGCAGG + Intronic
1114609090 14:24024767-24024789 GACACTCAGTTCCCAGGGGCAGG + Intergenic
1115121311 14:29941235-29941257 GTTCCACAGATCCCTAGGGCAGG - Intronic
1118492248 14:66272581-66272603 GATCAGCAGCTCCCCAGGGCAGG + Intergenic
1118524360 14:66622671-66622693 GTTCCACAGATCTCTGGGGCAGG + Intronic
1118837392 14:69486500-69486522 GAGCTACAGCCCCCAGGGCCAGG + Intronic
1118990926 14:70796366-70796388 GAGCCACACGTCCCAGGGCCTGG + Intronic
1119193811 14:72702397-72702419 TATCCCCAGCTCCAAGGAGCAGG - Intronic
1119531371 14:75363441-75363463 CATCCACAGCTTCCAGGGCTTGG + Intergenic
1119859474 14:77925850-77925872 GATCCCCGGCTCCCAGTCGCTGG - Exonic
1120406989 14:84102786-84102808 GTTCCACAGATTCCAAGGGCAGG - Intergenic
1120469315 14:84902910-84902932 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1121140813 14:91539964-91539986 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1121233017 14:92372230-92372252 GAGACCCAGGTCCCAGGGGCTGG - Intronic
1121511144 14:94514431-94514453 GAGTCACAGCCACCAGGGGCTGG - Intronic
1121638574 14:95470255-95470277 GTTTCACACCACCCAGGGGCAGG + Intronic
1121736124 14:96219394-96219416 GCTGCACAGCTCACAGGGGAGGG + Intronic
1121815337 14:96924379-96924401 AATCCAGAGATTCCAGGGGCAGG - Intronic
1122190632 14:100040074-100040096 GATCAACAGCTCATGGGGGCTGG - Intronic
1122694013 14:103544194-103544216 GGTCCACAGCTGCCCAGGGCGGG + Intergenic
1122960527 14:105091926-105091948 GAACCCCAGCTCCCAGGGCCTGG + Intergenic
1202836199 14_GL000009v2_random:79024-79046 GAGTCAGAGCTCCCAGGGGGAGG + Intergenic
1123739832 15:23226010-23226032 GATCGACTTCTCGCAGGGGCTGG - Intergenic
1124291058 15:28454983-28455005 GATCGACTTCTCGCAGGGGCTGG - Intergenic
1124658093 15:31524710-31524732 GAACTATGGCTCCCAGGGGCAGG + Intronic
1124675133 15:31678088-31678110 GTTCCACAGATCCCTAGGGCAGG - Intronic
1125836847 15:42759418-42759440 GAGGCACACCTGCCAGGGGCAGG - Intronic
1127319171 15:57826102-57826124 GATCCAGACCACCAAGGGGCTGG - Intergenic
1129266794 15:74397559-74397581 GATACAGAGGTCCCTGGGGCGGG - Intergenic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1132388101 15:101416283-101416305 GTTCCACAGATCTCTGGGGCAGG - Intronic
1132852512 16:2031199-2031221 GTCCCACAGGTCCCACGGGCAGG - Intronic
1133203569 16:4219328-4219350 GGGCCCCAGCTCCCAGGGACAGG - Intronic
1135401773 16:22170995-22171017 GACCCACAGCTCAGAGGGGAGGG + Intronic
1135585463 16:23667434-23667456 CATCCACAGGACCAAGGGGCTGG - Exonic
1135631582 16:24039726-24039748 CATACACAGCACCCAGGGGATGG + Intronic
1136139028 16:28276946-28276968 GAGCCACAGCTCCCGGGCGGTGG + Intergenic
1137555752 16:49469297-49469319 GAGCCACTGTTCCCAGGGGAGGG - Intergenic
1137609473 16:49809289-49809311 GGTCCACGGCTGGCAGGGGCCGG + Intronic
1137613531 16:49834589-49834611 GAGCCACTGCTCCCTGGGGTTGG + Intronic
1137764152 16:50964673-50964695 GAGCCACAGCTTCCAGGAACAGG - Intergenic
1138519704 16:57563921-57563943 GAGCCGCAGCTCCCTGGGGCGGG - Exonic
1139041254 16:63001653-63001675 GTTCCACAGATCTCAAGGGCAGG - Intergenic
1139936165 16:70572722-70572744 TATACACAGTTCTCAGGGGCAGG - Exonic
1139958345 16:70703987-70704009 GCACCACACCTGCCAGGGGCTGG + Intronic
1140188674 16:72796315-72796337 GCTCCACAGGTCCCAGCTGCGGG + Exonic
1141004510 16:80339696-80339718 TATCCAATCCTCCCAGGGGCAGG + Intergenic
1141065421 16:80909990-80910012 TATTAAAAGCTCCCAGGGGCCGG - Intergenic
1141158050 16:81610553-81610575 GAACCACAGCCGCCAGGGGCAGG - Intronic
1141705595 16:85662748-85662770 GATCCATGGCTCCCAGTAGCTGG - Intronic
1141750837 16:85956924-85956946 GATCCCTGGCACCCAGGGGCTGG - Intergenic
1142283181 16:89160111-89160133 GATCCCCAGCTCCTAGGGCAAGG + Intergenic
1142415095 16:89936811-89936833 GCCCCTCAGCTCCAAGGGGCGGG - Intergenic
1144032004 17:11331711-11331733 GATCCACAGCTCACATGGACAGG + Intronic
1144257162 17:13480446-13480468 GTTCCACAGCTCCCTAAGGCAGG - Intergenic
1144269627 17:13603140-13603162 CCTCCACAGCTTGCAGGGGCTGG - Intergenic
1144641871 17:16941779-16941801 GATGAACAGTTGCCAGGGGCTGG - Intronic
1144786249 17:17833490-17833512 GATCCACAGCTGCCCGGGGCTGG + Intronic
1145211521 17:21016747-21016769 GATCGGCAGCTACCAGGGTCTGG + Intronic
1146261909 17:31427515-31427537 TGTCCACAGCTCCCTGAGGCTGG - Intronic
1147584156 17:41643432-41643454 GATCCACAGCCCCATGGGCCTGG + Intergenic
1148556131 17:48579648-48579670 GGACCAAGGCTCCCAGGGGCAGG + Exonic
1149113417 17:53062431-53062453 GTTCCACAGCTCTCTAGGGCAGG - Intergenic
1149135490 17:53359064-53359086 GATCCACAGATCTCTAGGGCAGG - Intergenic
1149597218 17:57871406-57871428 GCTCCTGGGCTCCCAGGGGCAGG + Intronic
1149991784 17:61387589-61387611 GATGGACAGCCCCCAGGGGTAGG - Intronic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG + Intergenic
1152419766 17:80186129-80186151 CATTCACAGCTCCCAGGGTAGGG - Intronic
1152734939 17:81992637-81992659 GAAGCACAGCCCCCAGGGCCAGG - Intronic
1153477235 18:5510340-5510362 GATCTACAGCTGCCTGGGGATGG - Intronic
1153756997 18:8294315-8294337 GATGCACAGCTCCACAGGGCTGG + Intronic
1154161193 18:11981707-11981729 GAAGCACTCCTCCCAGGGGCCGG - Exonic
1154454796 18:14510887-14510909 GAGTCAGAGCTCCCAGGGGGAGG - Intronic
1156615910 18:38783957-38783979 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1157422908 18:47560909-47560931 GAGCCACAGCTCTGGGGGGCTGG - Intergenic
1159555435 18:69940610-69940632 GTTCCACAGATCTCTGGGGCAGG - Intronic
1160504347 18:79418588-79418610 GAGCCACAGCTCCCTGGAGAAGG + Intronic
1161737665 19:6001622-6001644 GACCAGCGGCTCCCAGGGGCAGG - Intronic
1161748721 19:6078155-6078177 GATTCACAGTTGCCCGGGGCTGG + Intronic
1162087630 19:8258063-8258085 GATCCCCAGCTCCTTGGGGCAGG - Intronic
1163311022 19:16514704-16514726 GAGCGGCAGCTCCCAGAGGCCGG + Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1164649166 19:29879651-29879673 GGTTCTCAGCTCTCAGGGGCTGG + Intergenic
1165214455 19:34260004-34260026 GATTCACAGTTCCCCAGGGCTGG - Intronic
1165480230 19:36058993-36059015 TCTCCACAGCTCTCAGAGGCAGG - Intronic
1166374929 19:42322396-42322418 GAGCTACAGATCCCAGAGGCGGG + Intronic
1166774076 19:45302052-45302074 GTCCCACATCTCCCAGGAGCTGG - Intronic
1167015523 19:46838599-46838621 GAGCCCCAGCTTCCAGGGTCCGG - Intronic
1167174494 19:47856272-47856294 GATCTCCAGCTCCCAGGCTCAGG - Intergenic
1167265131 19:48479269-48479291 GATCCACAGCCCCAAGGCCCAGG - Exonic
1167345653 19:48944208-48944230 GGTCCAAAGCTCCCCGGGGATGG + Intronic
1168311812 19:55464492-55464514 GGCACACAGCTCCCGGGGGCCGG + Intergenic
1202636437 1_KI270706v1_random:48338-48360 GAGTCAGAGCTCCCAGGGGGAGG - Intergenic
925001280 2:404715-404737 GTTCCACAGATCCCAGGGCAGGG + Intergenic
925317842 2:2939049-2939071 CCTCCACAGCTCCCAGGGGTGGG - Intergenic
928399876 2:30970145-30970167 GAACCAGATCTCACAGGGGCTGG + Intronic
928882259 2:36110367-36110389 GAATTATAGCTCCCAGGGGCTGG - Intergenic
929966209 2:46539040-46539062 GATCAACAGGTACCAGGGGCAGG + Intronic
930825506 2:55693280-55693302 GAGCCCCAGCTTCCAGGGTCCGG + Intronic
931494186 2:62784014-62784036 GTTCCACAGATCTCTGGGGCAGG + Intronic
932314228 2:70768742-70768764 GGTCCACAGCCCCCAAGGGCAGG - Intergenic
935622820 2:105144079-105144101 GAGCCGCAGCTGCCGGGGGCCGG - Intergenic
936872234 2:117146771-117146793 GTTCCACAGATCTCAAGGGCAGG + Intergenic
938282261 2:130072749-130072771 GAGTCAGAGCTCCCAGGGGGAGG - Intergenic
938332889 2:130461321-130461343 GAGTCAGAGCTCCCAGGGGGAGG - Exonic
938356919 2:130659350-130659372 GAGTCAGAGCTCCCAGGGGGAGG + Intergenic
938433355 2:131266156-131266178 GAGTCAGAGCTCCCAGGGGGAGG + Intronic
939272536 2:139959401-139959423 GATCCACAAATCTCTGGGGCAGG - Intergenic
939813120 2:146859534-146859556 CAGTCACAGCTCACAGGGGCTGG - Intergenic
943712438 2:191111948-191111970 GATCAACGGCTGCCTGGGGCTGG + Intronic
944458246 2:199917502-199917524 GTTCCACAGATCTCTGGGGCAGG + Intronic
944479833 2:200145156-200145178 GTTCCACAGATCCCTAGGGCAGG + Intergenic
946031500 2:216708582-216708604 GCCCCACACCTCCCAGGAGCTGG - Intergenic
948411525 2:237766140-237766162 GAACCACAGATCACAGGGGATGG - Intronic
948600164 2:239103338-239103360 GGGCCACAGCTGCCAGGGTCTGG + Intronic
948908419 2:240991069-240991091 GGTCCACAGCTCCCAAGGAGAGG - Intronic
948992305 2:241561328-241561350 CATCCTCGGCTGCCAGGGGCAGG + Intronic
1169447897 20:5687752-5687774 CATTCACAGGTCCCAGGGGTTGG + Intergenic
1170122020 20:12922252-12922274 GTTCCACAGATCCCCAGGGCAGG - Intergenic
1170567263 20:17614353-17614375 GAGCCACAGACCCCTGGGGCTGG + Intronic
1171272847 20:23829799-23829821 GACATACAGTTCCCAGGGGCAGG + Intergenic
1171882570 20:30629264-30629286 GAGTCAGAGCTCCCAGGGGGAGG - Intergenic
1172091129 20:32433725-32433747 GATCCACAGTTTCCTGAGGCAGG - Exonic
1172655881 20:36537765-36537787 GATCCATAGTCTCCAGGGGCTGG + Intergenic
1172740534 20:37162968-37162990 GCTCCAGAGCTCTCAGAGGCAGG - Intronic
1173433978 20:43016233-43016255 GCTCCACAGTGCCCAGGGTCTGG - Intronic
1174044088 20:47721039-47721061 GCTCCACAGCTCTCAGGGCTGGG + Intronic
1174533889 20:51236229-51236251 AATCCACAGCACCCAGGGTCTGG - Intergenic
1174576997 20:51543538-51543560 GAGCCAGAGCTCGAAGGGGCTGG + Intronic
1174615526 20:51832551-51832573 AACCCACAGCTCCCATGGGGTGG + Intergenic
1175783283 20:61696990-61697012 TGTCCGGAGCTCCCAGGGGCTGG + Intronic
1175873643 20:62219690-62219712 GGTCCCCAGCGGCCAGGGGCTGG + Intronic
1175966891 20:62664358-62664380 GCCCCACTTCTCCCAGGGGCTGG + Intronic
1176030418 20:63008740-63008762 GCTCCACAGGTCCCCGGAGCTGG + Intergenic
1176041079 20:63066206-63066228 GGTCCGCAGCTTCCATGGGCTGG + Intergenic
1176117500 20:63439454-63439476 GGTCCACAGCCCCCAGGAGCTGG - Intronic
1176337082 21:5609278-5609300 GAGCCACATCACCCAGGTGCTGG + Intergenic
1176390675 21:6211670-6211692 GAGCCACATCACCCAGGTGCTGG - Intergenic
1176423818 21:6535535-6535557 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1176470744 21:7104504-7104526 GAGCCACATCACCCAGGTGCTGG + Intergenic
1176494305 21:7486282-7486304 GAGCCACATCACCCAGGTGCTGG + Intergenic
1176506337 21:7652101-7652123 GAGCCACATCACCCAGGTGCTGG - Intergenic
1177367236 21:20153916-20153938 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1177367285 21:20154356-20154378 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1177637071 21:23801395-23801417 GATTCACAGTTCCCCAGGGCTGG + Intergenic
1177722601 21:24927553-24927575 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1178634304 21:34288803-34288825 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1179101794 21:38360837-38360859 GATTCACAGTTCCAAGTGGCTGG - Intergenic
1179306349 21:40156842-40156864 GATCCACAGATCTTTGGGGCAGG - Intronic
1179699311 21:43143850-43143872 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1180364431 22:11925976-11925998 GAGTCAGAGCTCCCAGGGGGAGG + Intergenic
1180961331 22:19763684-19763706 GATCCAGAGTTCCCTGGGGATGG - Intronic
1181874390 22:25928600-25928622 TATCCAAAGCTCCCAGTGGAGGG - Intronic
1183483577 22:38077730-38077752 GACTCACAGTTCCCAGGGTCAGG - Intergenic
1203293962 22_KI270736v1_random:22607-22629 GACATACAGTTCCCAGGGGCAGG - Intergenic
949611779 3:5710245-5710267 GTTCCACAGATCTCTGGGGCAGG + Intergenic
949881169 3:8662030-8662052 GATCCACAGTTCCACGTGGCTGG - Intronic
950429635 3:12943522-12943544 GACCCTCTGCTCCCACGGGCCGG + Intronic
950643050 3:14360671-14360693 GATGCTCATCTCCCAGGGTCTGG - Intergenic
951681784 3:25302575-25302597 GATTAGCAGCTTCCAGGGGCTGG + Intronic
952170115 3:30798314-30798336 GTTCCACAGTTCCCTGAGGCTGG + Intronic
953451482 3:43010073-43010095 AATCCAGAGCACCCTGGGGCAGG - Intronic
953906819 3:46872506-46872528 GAGATACACCTCCCAGGGGCAGG + Intronic
954581506 3:51705674-51705696 GAGCAACAGCTCCCTGGGGTAGG - Intergenic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
955112864 3:55966354-55966376 TTTCTAGAGCTCCCAGGGGCAGG + Intronic
955902654 3:63773952-63773974 GATCAACTGCTCCCAGTGCCAGG + Intergenic
957045936 3:75374643-75374665 GATGTTCAGTTCCCAGGGGCAGG + Intergenic
957557591 3:81781299-81781321 GCTCCACAGATCTCTGGGGCAGG + Intergenic
958541357 3:95478318-95478340 GTTTCACAGTTCCCAGGAGCAGG - Intergenic
959583243 3:108003131-108003153 CATCCCCAGCTCCCAGTAGCAGG + Intergenic
960724815 3:120659408-120659430 GTTCCACAGATCCCTAGGGCAGG + Intronic
961001644 3:123378212-123378234 TATCCACCCCTCCCAGGGACTGG - Intronic
961175417 3:124831232-124831254 TAAACACAGCTCCCAGAGGCAGG + Intronic
961467041 3:127088421-127088443 GAACCCCAGATCCCAGGGACTGG - Intergenic
962530799 3:136277943-136277965 AACCCATACCTCCCAGGGGCAGG - Intronic
963386287 3:144598760-144598782 GTTCCACAGTTCCCTGTGGCAGG + Intergenic
963921857 3:150913340-150913362 GAGCCACAGCTGCCAGGAGATGG - Intronic
965074864 3:163963492-163963514 GTTCCACAGATCCCTGGGGCAGG - Intergenic
965290449 3:166872346-166872368 GTTCCACAGATCCCTAGGGCTGG - Intergenic
967207829 3:187139571-187139593 GAGCCACAGCTCAGTGGGGCGGG - Intronic
967963383 3:194942412-194942434 GACCCAGAGCTCCCAGGCCCTGG - Intergenic
968073455 3:195802422-195802444 GATCCTCAGCTCTGAGGGCCAGG + Intronic
968360725 3:198144964-198144986 GATTCCCACCTCACAGGGGCAGG - Intergenic
968631396 4:1653981-1654003 CATCTACAGCCCCCAGAGGCAGG + Intronic
968711010 4:2117659-2117681 GATTCAGAGCTGCCATGGGCCGG - Intronic
968904986 4:3446885-3446907 GGACCACAGCTCCCAGGGTGGGG + Intronic
969463050 4:7338925-7338947 GACCAACAGCTCCCTGGTGCGGG - Intronic
969996999 4:11323609-11323631 GTTCCACAGATCCCTGGAGCAGG - Intergenic
971741409 4:30526143-30526165 GTTCCACAGATCCCTAGGGCAGG + Intergenic
972012774 4:34205589-34205611 GTTCCACAGGTCTCTGGGGCAGG - Intergenic
972140235 4:35950332-35950354 GTTCCACAGATCTCTGGGGCAGG + Intronic
972864334 4:43211908-43211930 GATCCACTGCTTCCTTGGGCTGG + Intergenic
973046543 4:45540954-45540976 GTTCCACAGATCCCTAGGGCAGG - Intergenic
973366244 4:49211707-49211729 GAGTCAGAGCTCCCAGGGGGAGG - Intergenic
973394359 4:49580728-49580750 GAGTCAGAGCTCCCAGGGGGAGG + Intergenic
975942068 4:79659960-79659982 GTTCCACAGATCTCTGGGGCAGG - Intergenic
978991169 4:115084227-115084249 GTTCCACAGCTCTCTAGGGCAGG - Intronic
981131289 4:141161255-141161277 GTTCCACAGATCCCTAGGGCAGG - Intronic
982790643 4:159587375-159587397 GTTCCACAGATCCCTAGGGCAGG + Intergenic
982843397 4:160220564-160220586 GATCCACAGATCCCTAAGGCAGG + Intergenic
1202763754 4_GL000008v2_random:134208-134230 GAGTCAGAGCTCCCAGGGGGAGG - Intergenic
985684388 5:1274155-1274177 GTTCCCCAGCCCCCAGGAGCTGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985959130 5:3286565-3286587 GAACCACAGCTGCCAGGGAGGGG + Intergenic
987153724 5:15066915-15066937 GATTCACAGCTCCGCAGGGCTGG + Intergenic
990193373 5:53286872-53286894 GTTCCACAGCTCTCTAGGGCAGG + Intergenic
990322786 5:54646440-54646462 GATCCACAGCTCACTGCTGCCGG + Intergenic
990327865 5:54696015-54696037 GATCCAGATCTCCAAGGGCCAGG - Intergenic
990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG + Intergenic
991136178 5:63185201-63185223 GTTCCACAGATCCCTAGGGCAGG - Intergenic
991157725 5:63458717-63458739 GGTACAGAGCTCCCAGGGGAGGG + Intergenic
991261641 5:64674935-64674957 AATCCAGAGCTGCCAGGGTCTGG - Intergenic
991527220 5:67574062-67574084 AATCCACAGGCCCCAGTGGCAGG - Intergenic
992178251 5:74172108-74172130 GTTCCAGAGGTCCCAGGGGCTGG + Intergenic
992666356 5:79013243-79013265 GATCCATAGATCCCTAGGGCAGG + Intronic
992826414 5:80554083-80554105 GATTCACAGCTCCACGTGGCTGG - Intergenic
995591678 5:113706260-113706282 GTTCCACAGATCCCTAGGGCAGG + Intergenic
996084231 5:119287613-119287635 GAACAGCAGCTGCCAGGGGCTGG - Intronic
997081632 5:130746487-130746509 GTTCCACAGATCCCTAGGGCAGG - Intergenic
997344686 5:133179535-133179557 GATTCATGGCTGCCAGGGGCTGG - Intergenic
997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG + Intergenic
998581935 5:143385600-143385622 GATCCACAGATCTCTAGGGCAGG + Intronic
999302122 5:150497715-150497737 GACTCACAGCTCCCAGCTGCTGG - Intronic
1000340439 5:160273170-160273192 GAACCACTGCTCCTAGGGGAAGG + Intronic
1000609553 5:163359409-163359431 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1000614232 5:163410186-163410208 GACCCACAGCACCCAGCTGCAGG - Intergenic
1000999666 5:167993954-167993976 GATGCTGAGCGCCCAGGGGCAGG + Intronic
1001082295 5:168676243-168676265 GATCCACAGCACCCAGGACGAGG - Intronic
1001098868 5:168797442-168797464 GATCCACTGCTCCCAACTGCAGG + Intronic
1001532289 5:172471900-172471922 GCTTCAAATCTCCCAGGGGCAGG + Intergenic
1001546146 5:172571500-172571522 GAGACACAGCTCACAGGTGCTGG - Intergenic
1001655645 5:173347468-173347490 GAGGCACAGCTCCTAGAGGCTGG - Intergenic
1002392883 5:178929493-178929515 GTTCCACAGATCCCTAGGGCAGG + Intronic
1002586794 5:180253631-180253653 GATGCCCAGCTTCCAGGTGCAGG + Intronic
1004565246 6:16789873-16789895 GATCCACAGATCCCTAGGGCAGG + Intergenic
1006837318 6:37006863-37006885 GCTCCAGAGCTCCCTGGGACAGG - Intronic
1007171541 6:39867633-39867655 GATGAACAACTCCCAGGGGCGGG + Exonic
1007181814 6:39934254-39934276 CGTCCACAGCTTCCCGGGGCAGG - Intronic
1007962171 6:45969872-45969894 GGTCCTGAGCTCCCAGGGGAAGG + Intronic
1008787304 6:55184211-55184233 GAGCCACTGCACCCAGGCGCAGG + Intronic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1010344914 6:74800061-74800083 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1011129690 6:84040734-84040756 GATCCACAGATCTCTAGGGCAGG - Intronic
1012555520 6:100506532-100506554 GATCCACCGCTCCCAAAGTCAGG + Intergenic
1014154891 6:118099091-118099113 GATCCACATTCCCTAGGGGCTGG + Intronic
1014247796 6:119085347-119085369 GTTCCACAGATCCCTAGGGCAGG + Intronic
1014255505 6:119157082-119157104 GACCCTCAGCCCCAAGGGGCTGG - Intergenic
1016462816 6:144296129-144296151 GCTCCCCAACTCCCAGGGCCTGG + Intronic
1016744541 6:147564385-147564407 AATCCACAGGTCCCAATGGCTGG + Exonic
1016790301 6:148060616-148060638 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1016849608 6:148603629-148603651 GATCTATAGCTGCCAGGAGCTGG - Intergenic
1016859953 6:148707593-148707615 TATCCACAGCATGCAGGGGCTGG - Intergenic
1018358179 6:163039672-163039694 GTTCCACAGATCTCAAGGGCAGG - Intronic
1018950434 6:168375153-168375175 AAGCCACAGGTCCCTGGGGCAGG + Intergenic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019259280 7:71668-71690 GATTCCCACCTCACAGGGGCAGG + Intergenic
1019344680 7:523430-523452 GATCCCCAGTTCCAAGGTGCAGG + Intergenic
1019702094 7:2478934-2478956 AAGCCACAGCACCCAGTGGCTGG - Intergenic
1022032260 7:26503242-26503264 GCTCCAGAGCCCGCAGGGGCTGG - Intergenic
1022532954 7:31078533-31078555 GATCCTCAGCGCCCAGTGGGAGG + Intronic
1024311452 7:47973308-47973330 CATCGACATCTCCCAGGAGCTGG + Intronic
1024865901 7:53904793-53904815 GTTCCACAGATCCCTAGGGCCGG + Intergenic
1024985176 7:55188006-55188028 GAGCCCCAGCCCCCAGGGGAAGG + Intronic
1026258003 7:68729476-68729498 GGTCCACAGGGCCCACGGGCAGG + Intergenic
1026483346 7:70797377-70797399 GATCCTCAGCTCCTGGAGGCAGG + Intergenic
1026766874 7:73165694-73165716 GAGCCACTGCTCCCAGCTGCTGG + Intergenic
1026966950 7:74446164-74446186 GATCCAGAGCTCCCAGGGGCAGG + Intergenic
1027043352 7:74975393-74975415 GAGCCACTGCTCCCAGCTGCTGG + Intronic
1027080295 7:75226966-75226988 GAGCCACTGCTCCCAGCTGCTGG - Intergenic
1027627826 7:80565739-80565761 GGGACTCAGCTCCCAGGGGCAGG - Intronic
1027913066 7:84278158-84278180 GTTCCACAGGTCCCTAGGGCAGG + Intronic
1029183850 7:98724526-98724548 GGACATCAGCTCCCAGGGGCAGG + Intergenic
1029389502 7:100265572-100265594 GAGCCACTGCTCCCAGCTGCTGG - Intronic
1029420479 7:100469437-100469459 GCTCAACAGCCCCCAGGGCCGGG + Intronic
1029633156 7:101765921-101765943 GAGCCACCGCTCCCAGGCTCAGG + Intergenic
1029939524 7:104465057-104465079 GTTCCACAGATCTCTGGGGCAGG + Intronic
1030072859 7:105712587-105712609 GTTCCACAGATCCCTAGGGCAGG + Intronic
1030103805 7:105969714-105969736 GATCCACAGAGGCCAGGTGCAGG - Intronic
1030722464 7:112885490-112885512 GTTCCACAGATCTCTGGGGCAGG + Intronic
1031645513 7:124221087-124221109 GTTCCACAGCTCTCTAGGGCAGG - Intergenic
1031795923 7:126174721-126174743 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1032192032 7:129770887-129770909 CTTCCCCAGCGCCCAGGGGCAGG - Intergenic
1034015798 7:147584871-147584893 TATCCTCAGCTCCCAGGATCAGG + Intronic
1034078632 7:148256661-148256683 GAGCCCCAGCTCCCATGCGCAGG + Intronic
1034987161 7:155523490-155523512 GAGCATCAGCTCCCAGAGGCTGG - Intronic
1035466976 7:159085827-159085849 GATCGGCAGTTGCCAGGGGCTGG + Intronic
1037919267 8:22792719-22792741 GGCCAACAGCTCCCATGGGCAGG - Intronic
1039148762 8:34479748-34479770 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1040087759 8:43364033-43364055 GAGTCAGAGCTCCCAGGGGGAGG + Intergenic
1041670582 8:60487828-60487850 GATCCATAGTTGCCAGGGGCTGG + Intergenic
1041682135 8:60604651-60604673 GTTCCACAGGTCCCTAGGGCAGG - Intronic
1042058061 8:64787370-64787392 GTTCCACAGATCTCTGGGGCCGG + Intronic
1042253789 8:66782647-66782669 GATCAGCAGCTGCCAGGGGCTGG - Intronic
1042307018 8:67343318-67343340 GACCCGCGGCTCCCAGCGGCTGG + Exonic
1045079113 8:98604930-98604952 GATCCACAGATCCCCAGGGCAGG + Intronic
1045207331 8:100056190-100056212 GTTCCACAGATCTCTGGGGCAGG - Intronic
1045905831 8:107343441-107343463 CTTCTACAGCTCCCAGGAGCAGG + Intronic
1047186440 8:122637348-122637370 GACCCAGAGCTCTCTGGGGCTGG - Intergenic
1048001532 8:130383249-130383271 GAAGCACTCCTCCCAGGGGCTGG - Intronic
1048658508 8:136570906-136570928 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1049199115 8:141331290-141331312 AAAACCCAGCTCCCAGGGGCTGG - Intergenic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049667617 8:143853564-143853586 GATCCACTGCACACAGCGGCTGG + Intergenic
1049876749 8:145028303-145028325 GACCTTCAGTTCCCAGGGGCAGG + Intergenic
1050358760 9:4807806-4807828 GACCCATAGCTGCCAGGCGCGGG - Intronic
1050940454 9:11451346-11451368 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1051365206 9:16316960-16316982 GAGCCTCAGCTCCCAGGAGAAGG - Intergenic
1051776474 9:20639594-20639616 GAGCCACAGCTCCCAGCTCCAGG + Intergenic
1052156868 9:25203173-25203195 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1052702267 9:31951289-31951311 GTTCCACAGATCCCCAGGGCAGG + Intergenic
1053106511 9:35414030-35414052 GATCAAAAGTTCCCAGTGGCCGG + Intergenic
1053882732 9:42612011-42612033 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1053889937 9:42682291-42682313 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1054221759 9:62419479-62419501 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1054228955 9:62489694-62489716 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1056092140 9:83216016-83216038 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1056822184 9:89851073-89851095 GCCCCACAGACCCCAGGGGCAGG + Intergenic
1057211320 9:93202541-93202563 GAGCCACAGCTCTCAGGGAGGGG + Intronic
1060528747 9:124335126-124335148 CATCCATAGCACCCAGGTGCTGG + Intronic
1060539740 9:124421309-124421331 GAAACACAGCTCCCATGGGAGGG + Intergenic
1060763409 9:126275147-126275169 GGTTCCCAGGTCCCAGGGGCTGG + Intergenic
1061295688 9:129675557-129675579 GATCCACTGCCCCCAGGGGGCGG + Intronic
1061330541 9:129889707-129889729 GATCTACAGTTCTCAGGGACAGG + Exonic
1061538956 9:131267037-131267059 GCACCACACCTCCCTGGGGCCGG + Intronic
1061596254 9:131631344-131631366 GATTGGCAGCTGCCAGGGGCTGG - Intronic
1062067407 9:134536159-134536181 GACCCACAGTCACCAGGGGCTGG - Intergenic
1062067426 9:134536215-134536237 GACCCACAGTCACCAGGGGCTGG - Intergenic
1062097242 9:134709804-134709826 GATCCACAGTTCCCAGAAGATGG + Intronic
1062123802 9:134848705-134848727 AATCCACACCTCCCAGGGCTGGG + Intergenic
1062535450 9:137019213-137019235 GATCCGCAGCTTCCTGGAGCAGG - Exonic
1062745428 9:138208795-138208817 GATTCCCACCTCACAGGGGCAGG - Intergenic
1203424570 Un_GL000195v1:25628-25650 GAGCCACATCACCCAGGTGCTGG - Intergenic
1203544508 Un_KI270743v1:119081-119103 GAGTCAGAGCTCCCAGGGGGAGG - Intergenic
1186488654 X:9953734-9953756 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1186530571 X:10291011-10291033 GATCCGTGGCTGCCAGGGGCTGG - Intergenic
1186861016 X:13672599-13672621 GATTCACAGTTACCTGGGGCTGG + Intronic
1187180616 X:16940019-16940041 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1188105693 X:26144691-26144713 GTTCCACAGATCCCTAGGGCAGG + Intergenic
1189285595 X:39850190-39850212 GACCCACCTCTCCCAGCGGCTGG - Intergenic
1189674200 X:43444099-43444121 GAGACAGAGCTCCCAGGGGAAGG - Intergenic
1190499627 X:51061927-51061949 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1190556781 X:51643868-51643890 GGTCCCCAGCTCCCAGGTGGGGG + Intergenic
1191602763 X:63027587-63027609 GATCCACAGATCTCTAGGGCAGG + Intergenic
1192923793 X:75734976-75734998 GAGACACATCTCCCAGGGGGAGG - Intergenic
1193519456 X:82511360-82511382 GATTCACAGTTCCAAGTGGCTGG + Intergenic
1193593913 X:83422632-83422654 GTTCCACAGCTCCCTAGGGCTGG - Intergenic
1194339889 X:92694684-92694706 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1194590726 X:95797205-95797227 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1194613661 X:96074876-96074898 GTTCCACAGGTCCCCTGGGCAGG + Intergenic
1194635535 X:96342069-96342091 GATGCAAAGCTCCCAGAGGGAGG - Intergenic
1194855060 X:98918194-98918216 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1195715915 X:107818719-107818741 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1196278474 X:113796226-113796248 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198593457 X:138210279-138210301 GATCCACAGATCTCTAGGGCAGG + Intergenic
1199383158 X:147193843-147193865 GTTCCACAGATCCCTAGGGCAGG - Intergenic
1199619345 X:149685619-149685641 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1199677375 X:150199680-150199702 GCTGCAAAGCTCCCAAGGGCAGG + Intergenic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200648276 Y:5811467-5811489 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1200752437 Y:6958877-6958899 GATGTTCAGTTCCCAGGGGCAGG + Intronic