ID: 1130997474

View in Genome Browser
Species Human (GRCh38)
Location 15:88912024-88912046
Sequence AGAGGGCCGGTGCAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130997474_1130997487 12 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997487 15:88912059-88912081 CCAGGGCAAAACGGTCCAGTGGG 0: 1
1: 0
2: 2
3: 4
4: 92
1130997474_1130997481 -5 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997481 15:88912042-88912064 CCTCTCCCTACACTGCTCCAGGG 0: 1
1: 0
2: 2
3: 41
4: 324
1130997474_1130997490 25 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997490 15:88912072-88912094 GTCCAGTGGGAAAAAGGGAAAGG 0: 1
1: 0
2: 4
3: 32
4: 390
1130997474_1130997485 11 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997485 15:88912058-88912080 TCCAGGGCAAAACGGTCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 99
1130997474_1130997488 19 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997488 15:88912066-88912088 AAAACGGTCCAGTGGGAAAAAGG 0: 1
1: 0
2: 0
3: 12
4: 170
1130997474_1130997479 -6 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997479 15:88912041-88912063 CCCTCTCCCTACACTGCTCCAGG 0: 1
1: 0
2: 7
3: 50
4: 424
1130997474_1130997489 20 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997489 15:88912067-88912089 AAACGGTCCAGTGGGAAAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 207
1130997474_1130997484 3 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997484 15:88912050-88912072 TACACTGCTCCAGGGCAAAACGG 0: 1
1: 0
2: 1
3: 13
4: 146
1130997474_1130997491 26 Left 1130997474 15:88912024-88912046 CCTCCCAACTGCACCGGCCCTCT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1130997491 15:88912073-88912095 TCCAGTGGGAAAAAGGGAAAGGG 0: 1
1: 0
2: 6
3: 58
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130997474 Original CRISPR AGAGGGCCGGTGCAGTTGGG AGG (reversed) Intronic
900109045 1:997982-998004 GGAGGGCCAGTGCTGGTGGGAGG + Intergenic
900184089 1:1324924-1324946 AGAGGGCCGGAGCGGGCGGGCGG + Exonic
900326205 1:2109866-2109888 AGAGGGCCAGGGCAGTGGGGTGG + Intronic
902770305 1:18641958-18641980 AGGGGGCCGCGGGAGTTGGGGGG - Intronic
903686519 1:25136017-25136039 CGGGGGCCGGCGGAGTTGGGGGG - Intergenic
905213635 1:36391472-36391494 AGAGGGCAGGTGCAGAGGGAAGG - Intronic
905827550 1:41037423-41037445 CAAGGGCCGGTGCCTTTGGGAGG + Exonic
906155042 1:43609135-43609157 AGAGGGGCAGTGCAGCAGGGAGG - Intronic
906306864 1:44725045-44725067 AGAGGGATGTTGCAGGTGGGGGG - Intronic
907424298 1:54369386-54369408 AGAGGGACTGTGCAGCTAGGTGG + Intronic
912465743 1:109872453-109872475 AGAGGGTTGGTGCAGATGGCAGG - Intergenic
914934974 1:151970779-151970801 AGATGGGCGGGGCAGGTGGGGGG + Intergenic
916217845 1:162412712-162412734 AAAGGGCTGGTGTAGGTGGGAGG + Intergenic
916561214 1:165935310-165935332 AGATGCCCAGTGCTGTTGGGTGG - Intergenic
920374735 1:205501859-205501881 AAAGGGCAAGTGCAGATGGGAGG - Intergenic
920963879 1:210686407-210686429 AAAGGGCCATTGGAGTTGGGAGG - Intronic
1063658539 10:8015713-8015735 AAAGGGCCCGAGCAGTTGGAAGG + Exonic
1067716018 10:48691518-48691540 AGCGGGCTGCTGGAGTTGGGGGG + Intronic
1069896341 10:71682534-71682556 ACAGGGACGGTGCTGTTGAGAGG - Intronic
1071034118 10:81222790-81222812 AGGGAGCTGGTGCAGTTGGAGGG + Intergenic
1073120907 10:101122137-101122159 AGAGGGCAGCAGCAGGTGGGAGG + Intronic
1073124455 10:101140846-101140868 AGAGGCCCTGTGCAGTGCGGTGG + Intergenic
1073446260 10:103582334-103582356 GGAGGGCCTGTGCAGGGGGGAGG - Intronic
1074528806 10:114282687-114282709 AGAGGGATGGGGCACTTGGGGGG + Intronic
1074780398 10:116798164-116798186 AGAGGGGCGGGGCGGTGGGGCGG + Intergenic
1076576397 10:131472704-131472726 AGAGGGTCTGTCCAGTTGGTCGG + Intergenic
1076703146 10:132284438-132284460 GGAGGGCAGGTGAGGTTGGGAGG + Intronic
1076703152 10:132284456-132284478 GGAGGGCAGGTGAGGTTGGGAGG + Intronic
1076848247 10:133080529-133080551 AGAGGGCGGGTCCAGTGAGGAGG - Intronic
1078097647 11:8310435-8310457 AGAGGGTTGGTGGAGATGGGGGG + Intergenic
1080263377 11:30374828-30374850 AGAGGGCTGGTGCAGCAGGTTGG - Intergenic
1083276909 11:61602023-61602045 AGAGGTCAGGAGCAGGTGGGAGG - Intergenic
1084489824 11:69472148-69472170 AATGGGCAGGTGCAGGTGGGGGG + Intergenic
1084787644 11:71452927-71452949 AGAGGGGTGCTGCAGCTGGGCGG + Intergenic
1088613617 11:111602368-111602390 AGGGGGCCGGGGCAGGGGGGCGG - Intergenic
1089785893 11:120906871-120906893 AGAGGGCTGGTTCAGAAGGGAGG + Intronic
1090357075 11:126147244-126147266 AAAGGGCAGGGGCAGTAGGGAGG - Intergenic
1090662274 11:128890866-128890888 AGAGGGATGGAGCAGATGGGGGG - Intergenic
1091396418 12:156445-156467 TGAGGGCTGGGGCAGCTGGGGGG + Intronic
1091742642 12:2971021-2971043 TGAGGGCAGGTGCAGTCGGAGGG - Intronic
1091817040 12:3446498-3446520 AGAAGGCCTGTGCAGGTTGGTGG - Intronic
1093118316 12:15237877-15237899 AGAGGGCTGGTGCTGTTCAGGGG + Intronic
1101047630 12:100826596-100826618 ACAGGGCCATTGCGGTTGGGAGG - Intronic
1101752691 12:107595633-107595655 AGAGGGGCAGTGGAGTTGGGCGG + Intronic
1101810162 12:108101012-108101034 AGAGGGCATTGGCAGTTGGGAGG - Intergenic
1104904040 12:132204037-132204059 AGGTGGCTGGTGCAGTGGGGCGG - Intronic
1105423316 13:20272242-20272264 AGAGGGCTGATTCAGCTGGGAGG + Intergenic
1106025170 13:25949266-25949288 AGCGGGCCATTGCAGGTGGGAGG + Intronic
1108075209 13:46672355-46672377 TGAGGTCCCGTGCAGATGGGTGG + Intronic
1108240419 13:48457886-48457908 CGAGGGCGGTGGCAGTTGGGGGG + Intronic
1110273653 13:73618697-73618719 AGAGGGAGGGAGCGGTTGGGGGG - Intergenic
1113765339 13:112877545-112877567 AGAGAGCAGGTGCAGCTTGGGGG + Intronic
1114083144 14:19218828-19218850 CGAGGGGCTGTGCAGTGGGGAGG + Intergenic
1115300822 14:31883142-31883164 AGGGGGCAGGTGGAGTTAGGAGG - Intergenic
1119348137 14:73943134-73943156 AAAGGGCCTGGGCAGCTGGGTGG - Intronic
1119577977 14:75745158-75745180 AAAGGGCCAGGGAAGTTGGGTGG + Exonic
1121339192 14:93094835-93094857 GTAGGGCCGGTGCAGATGGGTGG - Intronic
1121847563 14:97186707-97186729 AGAGGGGAGGGGCAGATGGGAGG - Intergenic
1122098652 14:99389614-99389636 AGACGGCCGGGGCAGCTGTGTGG - Intergenic
1122444616 14:101760535-101760557 AGAGGGGCGGGGCTGTCGGGTGG + Intergenic
1124400099 15:29340457-29340479 AGAGGGCCAGTGCAGGGGAGGGG + Intronic
1127256744 15:57299498-57299520 AGAGGGTCGGAGCAGTGGGGTGG - Intergenic
1127598526 15:60511845-60511867 AGAGGCCTGGTGCAGGTAGGAGG + Intronic
1128578129 15:68790027-68790049 AGGGGGCCAGTGCAGATGGAGGG + Intronic
1129707863 15:77804981-77805003 AGGGGTCAGGAGCAGTTGGGGGG - Intronic
1129757818 15:78109085-78109107 AGAGTGCCTGTCCAGTGGGGTGG - Intronic
1130997474 15:88912024-88912046 AGAGGGCCGGTGCAGTTGGGAGG - Intronic
1132579289 16:677754-677776 AGAGGGACGCGGCAGGTGGGAGG - Intronic
1132727300 16:1344517-1344539 CGAGAGCAGGTGCAGTTGTGGGG + Exonic
1134484213 16:14644401-14644423 TGAGGGCCGGTGCTTTTGAGAGG - Exonic
1136173702 16:28503667-28503689 TGAGGGCTGGTGGAGTGGGGCGG - Intronic
1140909417 16:79438098-79438120 AGAGGCCCCGTGGCGTTGGGGGG + Intergenic
1141369629 16:83474901-83474923 AGTGAGCCGGTGCAGTTCTGGGG + Intronic
1141949005 16:87328803-87328825 AGGTGGCAGGTGGAGTTGGGAGG - Exonic
1142144193 16:88485962-88485984 AGAGAGGAGGTGCAGTTGGTGGG + Exonic
1142510157 17:387693-387715 TGAGGGGCTGTGCAGCTGGGTGG - Intergenic
1143635883 17:8163419-8163441 AGAGGGCCAGTGCAGGTGCTGGG + Intronic
1144791305 17:17860908-17860930 ACAGAGCTGGTGCAGTTGGGTGG - Intronic
1148110828 17:45144007-45144029 GGAGGCCCGGACCAGTTGGGAGG + Exonic
1149035994 17:52135078-52135100 AGAGGGTCCATTCAGTTGGGGGG - Intronic
1149652136 17:58282042-58282064 ACAGGATCAGTGCAGTTGGGAGG + Intergenic
1149888924 17:60368507-60368529 ACAGGGCCATTGCGGTTGGGGGG + Intronic
1150510785 17:65750812-65750834 AGAAGGGCGGTGCAGCTGGCAGG - Intronic
1152192340 17:78896477-78896499 AGAGGGCAGGTGCCTCTGGGAGG - Intronic
1152427090 17:80223947-80223969 ATTGGGCTGGTGCAGTAGGGGGG + Intronic
1152700441 17:81815773-81815795 AGCAGGCTGGTGGAGTTGGGTGG + Intergenic
1152782936 17:82234397-82234419 AGAGAGCCAGTGCAGGTTGGGGG + Exonic
1153167570 18:2279982-2280004 AGAGGACAGGTGGAATTGGGTGG - Intergenic
1153193560 18:2569499-2569521 AGAGGGCTGTTGCAGTGGGTGGG - Intronic
1153534355 18:6084871-6084893 AGAGGGCCACTGCAGGTGGAGGG + Intronic
1154499844 18:14990503-14990525 CGAGGGGCTGTGCAGTGGGGAGG + Intergenic
1155332117 18:24729005-24729027 AGAGTGAGGCTGCAGTTGGGAGG - Intergenic
1157285599 18:46375133-46375155 TGAGGGCGGGGGGAGTTGGGAGG - Intronic
1157732147 18:50013382-50013404 AGGGTGTAGGTGCAGTTGGGAGG - Intronic
1160446512 18:78931893-78931915 AGACGGCAGGTGCAGTTTGAGGG - Intergenic
1161242173 19:3228599-3228621 TGGGGGACGGTGCAGGTGGGGGG + Intronic
1161319179 19:3633181-3633203 AGAGGACAGGTGAAGGTGGGCGG + Intronic
1161961640 19:7526652-7526674 GGCGGGCAGGTGCAGTTGGGCGG + Intronic
1161961652 19:7526688-7526710 GGCGGGCAGGTGCAGGTGGGTGG + Intronic
1162336143 19:10061746-10061768 AGAGGGCAGGTTAAGGTGGGTGG + Intergenic
1163359695 19:16837858-16837880 ATAAGGCCAGGGCAGTTGGGGGG + Intronic
1166203495 19:41253733-41253755 GGAGTGCAGGAGCAGTTGGGGGG - Intronic
1167002131 19:46751939-46751961 TGGGGGCCGGCGCAGTGGGGTGG + Intronic
1167589794 19:50398212-50398234 AGATGGCCTGGGCAGATGGGTGG + Intronic
925199887 2:1958748-1958770 AAGGGGCCTCTGCAGTTGGGTGG - Intronic
925847222 2:8044779-8044801 AGTGGGCCTGTAGAGTTGGGAGG - Intergenic
927486389 2:23491250-23491272 AGAGGCCCTCTGCAGGTGGGTGG + Intronic
930235554 2:48885549-48885571 AGTGGGCTGGAGGAGTTGGGAGG + Intergenic
933648481 2:84830847-84830869 AGAGGGCAGCTGGAGATGGGCGG + Intronic
934128973 2:88928031-88928053 AGAGGACAGTTGCAGTTTGGGGG + Intergenic
936292331 2:111235793-111235815 ACAGGGCTGGAGCAGTTGGATGG + Intergenic
938493436 2:131777807-131777829 TGAGGGGCTGTGCAGTGGGGAGG - Intergenic
938499055 2:131820858-131820880 CGAGGGGCTGTGCAGTGGGGAGG + Intergenic
944646464 2:201785449-201785471 AGAGGGTCCATTCAGTTGGGTGG + Intergenic
1169392656 20:5203001-5203023 GGAGGACAGGTGCAGGTGGGAGG + Intergenic
1173333619 20:42096049-42096071 AGGGAGCAGGTGCAGGTGGGAGG - Intronic
1175328852 20:58148881-58148903 AGGGGGCCGGTGCAGCTGGAGGG - Intergenic
1175570175 20:60012248-60012270 AGAGGGTGGGAGCAGGTGGGAGG + Intronic
1175940492 20:62535487-62535509 AGAGGCCCGGGGCAGCTGTGGGG + Intergenic
1176970947 21:15265094-15265116 AGAGGGCCCATGAACTTGGGAGG - Intergenic
1178849796 21:36203629-36203651 AAAGGGAGGGTGCAGTGGGGGGG + Intronic
1179714668 21:43280728-43280750 AGAGGGGAGGTGGAGGTGGGGGG + Intergenic
1180103608 21:45601938-45601960 AGGGGGCAGGTGGGGTTGGGGGG + Intergenic
1180294829 22:10874439-10874461 CGAGGGGCTGTGCAGTGGGGAGG - Intergenic
1180497635 22:15903853-15903875 CGAGGGGCTGTGCAGTGGGGAGG - Intergenic
1180784667 22:18540131-18540153 AGGGGCCCGGGGCCGTTGGGGGG - Intergenic
1180834551 22:18923331-18923353 AGAGGCCCTGTGGAGATGGGAGG + Intronic
1181128245 22:20714183-20714205 AGGGGCCCGGGGCTGTTGGGGGG - Intronic
1181147289 22:20858330-20858352 GCAGGGCCGCTGCAGGTGGGTGG - Intronic
1181241570 22:21479488-21479510 AGGGGCCCGGGGCTGTTGGGGGG - Intergenic
1182723466 22:32423391-32423413 AGAGGAAGGGTGGAGTTGGGGGG + Intronic
1185316687 22:50182390-50182412 GGAGGACAGGTGCAGGTGGGCGG - Intergenic
1185416642 22:50714274-50714296 AGAGGGCCGGTGCAGCAGCCAGG + Intergenic
1203284640 22_KI270734v1_random:148630-148652 AGAGGCCCTGTGGAGATGGGAGG + Intergenic
949413342 3:3789085-3789107 AGGGAGCAGGTGCAGTTGGCTGG + Intronic
953106230 3:39882842-39882864 GGGGGGCAGGTGCAGTGGGGAGG - Intronic
955623559 3:60892374-60892396 AGAGGGCTGGTTGAGTTGGTGGG - Intronic
956743402 3:72292279-72292301 AGAGGGTCAGTGGACTTGGGTGG + Intergenic
957231048 3:77515266-77515288 AGTGGGTCGGTGATGTTGGGAGG + Intronic
961659651 3:128461979-128462001 AGAAGGCCGGGGCAGGTGGGTGG + Intergenic
961794435 3:129399423-129399445 AGAGCGCCGGGGCTGATGGGAGG + Intergenic
963231652 3:142914527-142914549 AGAAGGTCAGTGCAGGTGGGAGG + Intergenic
967829744 3:193909020-193909042 AGAGGGCCAGACCAGTTAGGGGG + Intergenic
968704921 4:2073315-2073337 TGAGGGCCAGTGCAGTGTGGTGG - Intronic
968725347 4:2245380-2245402 AGAGGGCCTTTGAAGTGGGGAGG + Intergenic
968972669 4:3804042-3804064 AGAGGGGCTGTGCAGGTGTGGGG + Intergenic
969297946 4:6280601-6280623 ACAGGCCTGGTGCAGGTGGGAGG + Intronic
969339356 4:6530548-6530570 AGCGGGCAGGTTCAGTTGCGTGG - Intronic
969507516 4:7597417-7597439 AGAGGGCTATTGCAGTGGGGAGG + Intronic
969544242 4:7813922-7813944 AGTGGGCAGGTGGATTTGGGTGG + Intronic
969613189 4:8238253-8238275 TCAGGGCAGGTGCAGTGGGGCGG + Intronic
974203386 4:58669288-58669310 TGTGGGCCCCTGCAGTTGGGTGG - Intergenic
977716638 4:100190523-100190545 GGAGGGGCGGTGCAGGTGGGCGG - Intronic
977904216 4:102456927-102456949 AGAGTGCCTGTGCCTTTGGGTGG - Intergenic
981540283 4:145839288-145839310 CGAGGGCCGCTGCAGTGGAGAGG + Intronic
983369764 4:166843014-166843036 AGTGGGCCGGCGCTGCTGGGGGG + Intronic
984973529 4:185210275-185210297 GGAGGGCCGGCGGAGCTGGGCGG - Intronic
986717973 5:10537793-10537815 AGAGGGCTGCTGCAGTCGGTGGG + Intergenic
987985486 5:25140878-25140900 AGAGGGCCGCTAAAGTTAGGAGG + Intergenic
989383437 5:40831607-40831629 AGAGGGCAGGGGCAGTTGAAGGG - Exonic
991021369 5:61983269-61983291 AGAGGTGGGGTGCAGGTGGGAGG + Intergenic
991297114 5:65093204-65093226 TGAGAGCCAGTGGAGTTGGGAGG + Intergenic
997872751 5:137519654-137519676 AAATGGCCGGGGCATTTGGGTGG + Intronic
1002432648 5:179212362-179212384 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1002432681 5:179212477-179212499 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1002432701 5:179212560-179212582 TGAGGGCAGGTGCAGTGGGCAGG + Intronic
1002432723 5:179212624-179212646 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1002432734 5:179212656-179212678 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1002432745 5:179212688-179212710 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1002432756 5:179212720-179212742 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1002432766 5:179212751-179212773 TGAGGGCGGGTGCAGTGGGCAGG + Intronic
1006078279 6:31548302-31548324 ACAGGCCCGGTGCAGTGGTGGGG - Exonic
1006813591 6:36836628-36836650 TGAGAGCGGGTGCAGTGGGGAGG + Intronic
1007166393 6:39831780-39831802 AGGGGGCAGGTGCACTGGGGGGG + Intronic
1009833419 6:68967983-68968005 AGAAGGCCTGTGCAGCTGGTGGG + Intronic
1011805638 6:91069996-91070018 AGAGGGCCAGTGCAATTGGGAGG + Intergenic
1013609609 6:111782046-111782068 AGGGGGCCGATGAAGTTGGATGG - Intronic
1016293777 6:142552160-142552182 AGAGGGTCTGTTCAGTTGGTTGG - Intergenic
1017306757 6:152927143-152927165 AGAGGGAGGGAGCAGGTGGGAGG + Intergenic
1018700656 6:166423472-166423494 GGAGGGCAGGTGCATTTGGAGGG + Intronic
1019190062 6:170246436-170246458 TGAGGGCCGGTGCTGGGGGGCGG - Intergenic
1019190102 6:170246539-170246561 TGAGGGCCGGTGCTGGGGGGCGG - Intergenic
1019190167 6:170246711-170246733 TGAGGGCCGGTGCTGGGGGGCGG - Intergenic
1019190218 6:170246849-170246871 TGAGGGCCGGTGCTGGGGGGCGG - Intergenic
1019190232 6:170246884-170246906 TGAGGGCCGGTGCTGGGGGGCGG - Intergenic
1019814911 7:3192555-3192577 AGAGGGTGGGTGCAGTGGGAAGG - Intergenic
1025035821 7:55591993-55592015 AGAGGGGGGGTGCAGCTGAGAGG - Intergenic
1025110692 7:56213720-56213742 AGAGGGCCAGTGGATCTGGGAGG + Intergenic
1026307230 7:69152702-69152724 AGAGGGCCAGTGGATCTGGGAGG - Intergenic
1029562069 7:101309142-101309164 TGAGGACAGTTGCAGTTGGGTGG - Intergenic
1029575169 7:101398758-101398780 AGAGGGCCGCTGCAGAGGAGGGG + Intronic
1030421313 7:109309964-109309986 AGAGGGAGGCTGCAGGTGGGTGG - Intergenic
1034064398 7:148122519-148122541 AGGGGACAGGTGCAGTGGGGAGG + Intronic
1034411807 7:150945970-150945992 AGAGGGCCGGGGCAGGCGGGAGG + Intronic
1034972699 7:155428915-155428937 ATAGAGTCGGTGCAGGTGGGGGG + Intergenic
1042124560 8:65525104-65525126 AGAGGGCCAGTGTGGTTGGAGGG - Intergenic
1043396595 8:79843216-79843238 ATAGGGCTGGTGCAGTTTGCTGG - Intergenic
1047277443 8:123416707-123416729 AGAGGGCCGGGGCAGTTTCCGGG - Exonic
1047432557 8:124805425-124805447 AGAGGGAAGGGGAAGTTGGGAGG + Intergenic
1048152157 8:131904336-131904358 CGAGGGCCGGGGGCGTTGGGAGG + Intronic
1049558541 8:143296017-143296039 AGAGGGCGGGGGCAGCTGGAAGG + Exonic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1053114660 9:35490303-35490325 AGAGGGCGGGTGCAGCCGAGGGG - Intronic
1056568252 9:87793796-87793818 AGAGGTCAGGGGGAGTTGGGAGG - Intergenic
1060927920 9:127468187-127468209 AGAGGGCCAGTGTAGCTGGAGGG + Intronic
1061083942 9:128388496-128388518 AGGTGGCCGGTGCAGTTGTGAGG + Intronic
1061406346 9:130394800-130394822 GGAGGGCTGGTGCAGTTAAGGGG + Intronic
1203441709 Un_GL000219v1:15693-15715 GGAGACCCGGTGCAGCTGGGCGG - Intergenic
1203512519 Un_KI270741v1:134602-134624 GGAGACCCGGTGCAGCTGGGCGG - Intergenic
1187094227 X:16129606-16129628 AAAGAGCCTGTGCAGCTGGGAGG - Intronic
1189884954 X:45533102-45533124 AGAGAGCCTGTGCACTTGGGTGG + Intergenic
1193810039 X:86040304-86040326 AGAGGGGATGTGCAGTTGAGTGG - Intronic
1196787565 X:119434432-119434454 AGAAGGCCAGTGCAGTTGAAGGG + Intronic
1197571267 X:128153628-128153650 CCAGGGCCTGTGCGGTTGGGGGG + Intergenic