ID: 1131006959

View in Genome Browser
Species Human (GRCh38)
Location 15:88986210-88986232
Sequence TCCGAACACATGGTGTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131006951_1131006959 21 Left 1131006951 15:88986166-88986188 CCCACCTTAGTCCTCTAATATGC No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data
1131006956_1131006959 10 Left 1131006956 15:88986177-88986199 CCTCTAATATGCAAATGCGGGTC No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data
1131006948_1131006959 30 Left 1131006948 15:88986157-88986179 CCTGGCCCTCCCACCTTAGTCCT No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data
1131006953_1131006959 17 Left 1131006953 15:88986170-88986192 CCTTAGTCCTCTAATATGCAAAT No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data
1131006949_1131006959 25 Left 1131006949 15:88986162-88986184 CCCTCCCACCTTAGTCCTCTAAT No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data
1131006950_1131006959 24 Left 1131006950 15:88986163-88986185 CCTCCCACCTTAGTCCTCTAATA No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data
1131006952_1131006959 20 Left 1131006952 15:88986167-88986189 CCACCTTAGTCCTCTAATATGCA No data
Right 1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131006959 Original CRISPR TCCGAACACATGGTGTTATC TGG Intergenic
No off target data available for this crispr