ID: 1131009150

View in Genome Browser
Species Human (GRCh38)
Location 15:89002971-89002993
Sequence CCCACCAGCCATGAGATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131009145_1131009150 5 Left 1131009145 15:89002943-89002965 CCCGCTTCCTAGAAGCAGACTGT No data
Right 1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG No data
1131009146_1131009150 4 Left 1131009146 15:89002944-89002966 CCGCTTCCTAGAAGCAGACTGTT No data
Right 1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG No data
1131009147_1131009150 -2 Left 1131009147 15:89002950-89002972 CCTAGAAGCAGACTGTTTATCCC No data
Right 1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG No data
1131009144_1131009150 6 Left 1131009144 15:89002942-89002964 CCCCGCTTCCTAGAAGCAGACTG No data
Right 1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG No data
1131009143_1131009150 12 Left 1131009143 15:89002936-89002958 CCGCTGCCCCGCTTCCTAGAAGC No data
Right 1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131009150 Original CRISPR CCCACCAGCCATGAGATGTG TGG Intergenic
No off target data available for this crispr