ID: 1131015008

View in Genome Browser
Species Human (GRCh38)
Location 15:89050770-89050792
Sequence CTGAGTTACCCCCATGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131015005_1131015008 -1 Left 1131015005 15:89050748-89050770 CCCTGAGGAAGGCAAGGGCAGCC No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131014999_1131015008 12 Left 1131014999 15:89050735-89050757 CCAGTTCCCTCAGCCCTGAGGAA No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131015002_1131015008 5 Left 1131015002 15:89050742-89050764 CCTCAGCCCTGAGGAAGGCAAGG No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131014996_1131015008 17 Left 1131014996 15:89050730-89050752 CCTTCCCAGTTCCCTCAGCCCTG No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131015001_1131015008 6 Left 1131015001 15:89050741-89050763 CCCTCAGCCCTGAGGAAGGCAAG No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131015006_1131015008 -2 Left 1131015006 15:89050749-89050771 CCTGAGGAAGGCAAGGGCAGCCT No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131014998_1131015008 13 Left 1131014998 15:89050734-89050756 CCCAGTTCCCTCAGCCCTGAGGA No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data
1131014995_1131015008 20 Left 1131014995 15:89050727-89050749 CCACCTTCCCAGTTCCCTCAGCC No data
Right 1131015008 15:89050770-89050792 CTGAGTTACCCCCATGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131015008 Original CRISPR CTGAGTTACCCCCATGAGTT AGG Intergenic
No off target data available for this crispr