ID: 1131016729

View in Genome Browser
Species Human (GRCh38)
Location 15:89063899-89063921
Sequence CTGCACAGCTGCACAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131016729_1131016731 1 Left 1131016729 15:89063899-89063921 CCTTCTGCTGTGCAGCTGTGCAG No data
Right 1131016731 15:89063923-89063945 TGTGCAGCCTGGTTCTTAACAGG 0: 6
1: 183
2: 426
3: 887
4: 1241
1131016729_1131016730 -10 Left 1131016729 15:89063899-89063921 CCTTCTGCTGTGCAGCTGTGCAG No data
Right 1131016730 15:89063912-89063934 AGCTGTGCAGCTGTGCAGCCTGG No data
1131016729_1131016734 12 Left 1131016729 15:89063899-89063921 CCTTCTGCTGTGCAGCTGTGCAG No data
Right 1131016734 15:89063934-89063956 GTTCTTAACAGGCCACGGACAGG No data
1131016729_1131016736 25 Left 1131016729 15:89063899-89063921 CCTTCTGCTGTGCAGCTGTGCAG No data
Right 1131016736 15:89063947-89063969 CACGGACAGGTGCCAGTCCATGG No data
1131016729_1131016732 7 Left 1131016729 15:89063899-89063921 CCTTCTGCTGTGCAGCTGTGCAG No data
Right 1131016732 15:89063929-89063951 GCCTGGTTCTTAACAGGCCACGG 0: 12
1: 238
2: 467
3: 707
4: 763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131016729 Original CRISPR CTGCACAGCTGCACAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr