ID: 1131016948

View in Genome Browser
Species Human (GRCh38)
Location 15:89065771-89065793
Sequence TGTTATTTCTATATCATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131016948_1131016953 7 Left 1131016948 15:89065771-89065793 CCCCCCATGATATAGAAATAACA No data
Right 1131016953 15:89065801-89065823 GCTTGCTTCTGTCCTAATGCAGG No data
1131016948_1131016957 22 Left 1131016948 15:89065771-89065793 CCCCCCATGATATAGAAATAACA No data
Right 1131016957 15:89065816-89065838 AATGCAGGATCCCAGGGAAAAGG No data
1131016948_1131016954 15 Left 1131016948 15:89065771-89065793 CCCCCCATGATATAGAAATAACA No data
Right 1131016954 15:89065809-89065831 CTGTCCTAATGCAGGATCCCAGG No data
1131016948_1131016955 16 Left 1131016948 15:89065771-89065793 CCCCCCATGATATAGAAATAACA No data
Right 1131016955 15:89065810-89065832 TGTCCTAATGCAGGATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131016948 Original CRISPR TGTTATTTCTATATCATGGG GGG (reversed) Intergenic
No off target data available for this crispr