ID: 1131018216

View in Genome Browser
Species Human (GRCh38)
Location 15:89075345-89075367
Sequence CAAGCTCACTCCATCCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131018216_1131018219 13 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018219 15:89075381-89075403 AAGGGTGAGTAGAGTTTTCCAGG 0: 1
1: 1
2: 3
3: 28
4: 208
1131018216_1131018217 -6 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018217 15:89075362-89075384 AGCTTGCAGCAGAGTCTCAAAGG 0: 1
1: 0
2: 4
3: 51
4: 252
1131018216_1131018221 18 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018221 15:89075386-89075408 TGAGTAGAGTTTTCCAGGTAGGG No data
1131018216_1131018222 28 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018222 15:89075396-89075418 TTTCCAGGTAGGGAAGTGTGTGG No data
1131018216_1131018218 -5 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018218 15:89075363-89075385 GCTTGCAGCAGAGTCTCAAAGGG 0: 1
1: 0
2: 4
3: 43
4: 244
1131018216_1131018223 29 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018223 15:89075397-89075419 TTCCAGGTAGGGAAGTGTGTGGG No data
1131018216_1131018220 17 Left 1131018216 15:89075345-89075367 CCTTTATGGATGGAGTGAGCTTG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1131018220 15:89075385-89075407 GTGAGTAGAGTTTTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131018216 Original CRISPR CAAGCTCACTCCATCCATAA AGG (reversed) Intergenic
903031888 1:20469631-20469653 CAAACTCACTCCCTTGATAATGG + Intergenic
906614331 1:47224589-47224611 CCACCTCACCCCACCCATAAGGG + Intronic
908153231 1:61326150-61326172 AAAGCTCCCTCCACCCAAAAAGG - Intronic
908438119 1:64126826-64126848 CAAGGTCCCTCCATCCAACAAGG - Intronic
910425460 1:87116262-87116284 TAAGCTGACTCCATCCTTCAAGG - Intronic
914997271 1:152555590-152555612 CAATCTAACTTCATCCCTAAAGG + Intronic
919159501 1:193809582-193809604 CAAACTCACTCCTGCAATAATGG - Intergenic
923930284 1:238686685-238686707 CCATCTCACTCCATTCAGAATGG + Intergenic
924711065 1:246530500-246530522 CCAGCACACTCCCTCCATTAAGG + Intergenic
1066202647 10:33157053-33157075 CCATCTCACTCCATACATAAAGG - Intergenic
1068060271 10:52060227-52060249 TTAGCTCACACCATACATAATGG + Intronic
1070481333 10:76885674-76885696 CCAGCCTAGTCCATCCATAAGGG + Exonic
1071036245 10:81249513-81249535 CAACATTAATCCATCCATAAGGG - Intergenic
1071469944 10:85976885-85976907 CAGGTTTACTCCAACCATAATGG + Intronic
1071849166 10:89551070-89551092 CACCCTCACTCCATCCAAAATGG - Intronic
1077609714 11:3636809-3636831 CCAGCTCACCCCATCCTTCAGGG - Intergenic
1079306662 11:19329445-19329467 CAGGCTCACTCCCTGCAGAATGG - Intergenic
1080113781 11:28599203-28599225 TAACCTGATTCCATCCATAAAGG - Intergenic
1085627808 11:78086753-78086775 CAAGGTCAATCGATCCATTAAGG - Intergenic
1087918491 11:103837877-103837899 CAATCTCACACCAGCCAGAATGG + Intergenic
1089884945 11:121811312-121811334 CAATCTCACACCAACCAGAATGG - Intergenic
1091197326 11:133742946-133742968 CAAACCCACTCCCTCAATAATGG + Intergenic
1095692598 12:45107307-45107329 CAATCTCACACCACCCAGAATGG - Intergenic
1095697763 12:45159812-45159834 CAATCTCACACCAGTCATAATGG - Intergenic
1096915212 12:55024539-55024561 CAAGCCCACTCCATCCTTTTTGG + Intronic
1099227451 12:79986590-79986612 CAACCTCACTCCAGCCTTCAGGG + Intergenic
1101544965 12:105703911-105703933 CATGCTCAGTCCATCCCCAAGGG - Intergenic
1103944077 12:124516691-124516713 CAAGGTCACACCATCCTTGAGGG + Intronic
1104957073 12:132472137-132472159 CCGGCTCACTCCTTCCATGAGGG - Intergenic
1108331543 13:49389860-49389882 CAACTGCACTCCAACCATAATGG - Intronic
1110096549 13:71530535-71530557 CAAGCTCACTTCTTCCACTATGG - Intronic
1110488855 13:76079132-76079154 CCAGCTCACTCCAGTCAGAATGG + Intergenic
1112067997 13:95815105-95815127 AAAGCTAACATCATCCATAATGG + Intronic
1112721411 13:102250109-102250131 AAAGCTTACTCCTTCCATGATGG - Intronic
1117467632 14:56009188-56009210 CCATCTCACTCCAACCAGAATGG - Intergenic
1119235774 14:73018005-73018027 CCAGCTCACTCCAGCCACACTGG + Intronic
1120631386 14:86895858-86895880 CAAGCTCACTTCATCTGTACAGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1131018216 15:89075345-89075367 CAAGCTCACTCCATCCATAAAGG - Intergenic
1131437951 15:92438061-92438083 GGAGCTCACTCCAGCCCTAATGG + Intronic
1134084547 16:11347321-11347343 CAAGATCACTTCATTCCTAAGGG + Intronic
1135038115 16:19095372-19095394 AAAGGTTTCTCCATCCATAATGG - Intergenic
1135543736 16:23351952-23351974 CAAGCTCACTCCACTGATAAAGG - Intronic
1135628920 16:24020829-24020851 CAAGCTAACAGCATCCATAGAGG - Intronic
1135888023 16:26330318-26330340 CCAGCTAACTTCATACATAATGG + Intergenic
1135934609 16:26769044-26769066 CAAGGTCAGTCCATGCAAAAAGG + Intergenic
1136648473 16:31644238-31644260 CCAGCTCACACCATTCAGAATGG - Intergenic
1137752626 16:50878097-50878119 CACACACACTCCATCCATGAAGG - Intergenic
1139061452 16:63257781-63257803 CTGTCTCACTCCAGCCATAATGG - Intergenic
1140771787 16:78212222-78212244 AAAGCTCACTCCATGGAAAAGGG + Intronic
1143974820 17:10821915-10821937 CTAGCTGGCTCAATCCATAAAGG - Intergenic
1148869686 17:50649529-50649551 AAAGCTGACTCCATACATAGTGG - Intronic
1149176721 17:53880956-53880978 CCAGCTCACACCATTCAGAATGG + Intergenic
1149683712 17:58522811-58522833 CAAACCCACTCCATCCTTCAAGG + Intronic
1151466279 17:74287582-74287604 CAAGCTAAGTCCATCCATAGGGG + Intronic
1153571190 18:6475211-6475233 CAAGGACACCCCATCCATTAAGG - Intergenic
1156518835 18:37704404-37704426 CTATCTCACTCCAGCCATAATGG - Intergenic
1166756755 19:45197116-45197138 ATAGCTCACTGCAGCCATAAGGG - Intronic
927036286 2:19180151-19180173 CAACCTCACTCCAGCAAGAATGG - Intergenic
929790348 2:45017867-45017889 CAGGCTCACCCCAGGCATAATGG - Intergenic
931546726 2:63396535-63396557 CACGCTCACTCCTTCCATGTTGG - Intronic
937883178 2:126883419-126883441 AAAGCTCCCTCCACCCATAATGG + Intergenic
938009821 2:127820089-127820111 CCAGCACACTCCCTCCATTAAGG + Intergenic
938598441 2:132812525-132812547 CAAGCACACTCCCTGCATCAAGG + Intronic
940682770 2:156807163-156807185 CAACATTAATCCATCCATAAGGG + Intergenic
941395838 2:164971655-164971677 CAATACCACTCCATCCAAAATGG - Intergenic
946105046 2:217361725-217361747 CAGGCCCACTCCATCAACAAAGG - Intronic
1175403316 20:58712647-58712669 CCAGCTCACTCCAGGCATATCGG + Intronic
1180973212 22:19826845-19826867 CAACCTCAATCCAGCCATAAAGG + Intronic
952328558 3:32342649-32342671 CAAGCTCAGTCCATACATGCAGG + Intronic
960851163 3:122056175-122056197 CAAGTTCACACTATTCATAAGGG + Intronic
963524794 3:146404394-146404416 CAAGCATACTCCTGCCATAATGG + Intronic
963688592 3:148470262-148470284 CAAGTTCACTCCATCCATCCTGG + Intergenic
964831273 3:160886327-160886349 AAAGCACACCCCATCCACAAAGG + Intronic
965517310 3:169635146-169635168 CAAAGTCACACCATTCATAAAGG - Intronic
968692167 4:1997755-1997777 GAAGCACACTCCCTCCATCATGG + Intronic
970126294 4:12815961-12815983 CAAGTACACCCCATCCATAGAGG + Intergenic
972987721 4:44785130-44785152 CAAGCTCTCTTCATCCATTGGGG + Intergenic
973762063 4:54126891-54126913 CTAGTTCACTCCATTCATGAGGG + Intronic
974155593 4:58068163-58068185 CAATCTCACGCCATTCAGAATGG + Intergenic
975490320 4:74981431-74981453 CAATCTCACGCCATTCAGAATGG + Intronic
979272103 4:118775026-118775048 CAAGATCATTTCATCCACAAGGG + Intronic
982319955 4:154067484-154067506 CAATGTCCCTCCACCCATAAGGG - Intergenic
982663120 4:158229520-158229542 GAAGCTCACCCCCTCCAAAAGGG - Intronic
983574224 4:169242704-169242726 CAAACCCACTCCCTTCATAAAGG - Intronic
984902404 4:184596918-184596940 CAAGCTCAGTCCATTCAGAGTGG - Intergenic
986496601 5:8348155-8348177 CAACCTCACTCCAGTCAGAATGG + Intergenic
987634847 5:20526410-20526432 CAGCCAGACTCCATCCATAAGGG + Intronic
988242762 5:28634661-28634683 CAAGGTGCCTCAATCCATAAAGG - Intergenic
997085811 5:130797078-130797100 CATGAGCACTCCATCCAGAAAGG - Intergenic
999663797 5:153892487-153892509 CCACCTCACTCCAGCCAGAATGG + Intergenic
1002992258 6:2248859-2248881 CACGCTCCCTCCATCCATGCTGG - Intergenic
1004169577 6:13285437-13285459 CAACCTCACTCCTTCCTCAAGGG - Intronic
1005105580 6:22221066-22221088 CACGGTCCCTCCATCAATAATGG - Intergenic
1008123537 6:47644595-47644617 CAAGCTCACTGCATCCTTTCAGG - Intergenic
1009802056 6:68551152-68551174 GAAACACACTTCATCCATAAAGG + Intergenic
1010023233 6:71185960-71185982 CAAGCTCACATCAGTCATAATGG + Intergenic
1015182809 6:130379035-130379057 CTAACCCACTCCTTCCATAATGG + Intronic
1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG + Intronic
1016206969 6:141480021-141480043 GAAGCTAAATCCATCCATATAGG + Intergenic
1018999272 6:168734838-168734860 CAAGATCAAGCCATTCATAAAGG + Intergenic
1021391137 7:20094386-20094408 CCATCTCACTCCAGTCATAATGG + Intergenic
1021987558 7:26111617-26111639 CAAGTGGAATCCATCCATAATGG + Intergenic
1024257650 7:47550318-47550340 CAAGCCCTCTCCATACATCAAGG - Intronic
1024881060 7:54085900-54085922 CATTCCAACTCCATCCATAAGGG + Intergenic
1026828880 7:73599887-73599909 CAAGCTCATTCCACCCAAGACGG - Intronic
1028536134 7:91889982-91890004 CAAGCTAACTCAACCCAAAAAGG + Intergenic
1034924735 7:155111961-155111983 CAATCTCACAGCATCCATACAGG - Intergenic
1036194675 8:6703768-6703790 GAAGCTGACCCCACCCATAATGG - Intergenic
1037335045 8:17783798-17783820 CATGCAGACTCCATCCTTAACGG + Intronic
1039021608 8:33213543-33213565 CAAGGTGACTCAATTCATAACGG + Intergenic
1044023866 8:87143321-87143343 AAAGCTCACTACATTCATAATGG - Intronic
1049630653 8:143654127-143654149 CAAGCTTACCCCATTCATGAGGG + Exonic
1051573816 9:18591405-18591427 GAAGCTCACTTCACCTATAAGGG - Intronic
1052873199 9:33528525-33528547 CAAGCTCATTCTATCCAAATAGG + Intronic
1053502902 9:38616224-38616246 CAAGCTCATTCTATCCAAATAGG - Intergenic
1054898147 9:70337354-70337376 TAATCTCAGTCCATCTATAAGGG - Intronic
1058909075 9:109504617-109504639 CAAACTCCCTCCATCCTTGAGGG - Intergenic
1060234597 9:121853489-121853511 CACACTCACTCCAGCCAGAATGG - Intronic
1060809781 9:126604975-126604997 CAACCTCATTCCATACAAAAGGG + Intergenic
1185978958 X:4755048-4755070 CAAGCTCATACCATCACTAAGGG - Intergenic
1189085001 X:38013715-38013737 CAGGCTCACTCAATCTATACTGG + Intronic
1193483120 X:82052208-82052230 CAATCTCACACCAGCCACAATGG + Intergenic
1194829861 X:98609321-98609343 CAAATTCTCTCCACCCATAATGG - Intergenic
1195498924 X:105571105-105571127 AAAGCTCCTTCCATCTATAAAGG - Intronic
1196366546 X:114930831-114930853 CAAGCCCACTCCCACGATAATGG + Intergenic
1197771559 X:130092606-130092628 CAGGCTCACTCCACCCCTCAAGG - Intronic
1198895236 X:141446832-141446854 CCATCTCACTCCAGCCAGAATGG - Intergenic
1198931472 X:141865856-141865878 GAAGCTCAGTCCATCTATAGAGG - Intronic
1199776542 X:151016556-151016578 CAAACTCACTCCATCACTATGGG + Intergenic
1200674232 Y:6130910-6130932 CAACCTCACTCTGCCCATAATGG + Intergenic
1201406375 Y:13654162-13654184 TAAGCTCAATCCATCGATAGTGG + Intergenic
1201761986 Y:17550536-17550558 CCATCTCACACCAGCCATAATGG + Intergenic
1201839566 Y:18355454-18355476 CCATCTCACACCAGCCATAATGG - Intergenic
1202082060 Y:21093429-21093451 AAAGCACACTCCCTCCATCAAGG + Intergenic