ID: 1131019971

View in Genome Browser
Species Human (GRCh38)
Location 15:89089132-89089154
Sequence CTAGAGCTGTCCAGCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131019966_1131019971 16 Left 1131019966 15:89089093-89089115 CCGGCACTGTTCTAGGCCCTTCG 0: 1
1: 0
2: 2
3: 33
4: 221
Right 1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88
1131019968_1131019971 -1 Left 1131019968 15:89089110-89089132 CCTTCGTGAGCTTTTCCCACAGC 0: 1
1: 0
2: 0
3: 2
4: 125
Right 1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88
1131019967_1131019971 0 Left 1131019967 15:89089109-89089131 CCCTTCGTGAGCTTTTCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88
1131019965_1131019971 22 Left 1131019965 15:89089087-89089109 CCGCGACCGGCACTGTTCTAGGC 0: 1
1: 0
2: 1
3: 10
4: 68
Right 1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88
1131019962_1131019971 24 Left 1131019962 15:89089085-89089107 CCCCGCGACCGGCACTGTTCTAG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88
1131019963_1131019971 23 Left 1131019963 15:89089086-89089108 CCCGCGACCGGCACTGTTCTAGG 0: 1
1: 0
2: 0
3: 20
4: 80
Right 1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131019971 Original CRISPR CTAGAGCTGTCCAGCAGCGC AGG Intronic
900098362 1:949693-949715 CTGGAGCTGGGCAGCAGAGCTGG + Intronic
900380702 1:2382466-2382488 CCAGAGCTGTGCACCAGCGCCGG + Intronic
905024528 1:34840595-34840617 CTAGACCTGTCCAACAGCCATGG + Intronic
907632281 1:56094835-56094857 CTAGAGCTGTCCAACAACCAAGG + Intergenic
913405755 1:118488992-118489014 CTAAAGCTGTACAACAGTGCAGG - Intergenic
916201193 1:162273126-162273148 CCAGAGTTGTCCTGCAGAGCAGG - Intronic
921056114 1:211543741-211543763 CTGGAGCTTTACAGCAGCACAGG - Intergenic
921580696 1:216892820-216892842 CTAGAGGTGCCAAGCAGGGCGGG - Intronic
1063936903 10:11087733-11087755 CTAGCACTATCCAGCAACGCAGG - Intronic
1065833037 10:29631904-29631926 CTAGAACTTTCCAGCAGTTCTGG - Intronic
1069858278 10:71453751-71453773 CCAGAGCTGTCCCACAGCGAGGG + Intronic
1073400105 10:103250525-103250547 CTTGAGCTGTCCAACATCCCTGG + Intergenic
1075674593 10:124287581-124287603 ACAGAGCTGTCCAGGAGCGCGGG - Intergenic
1078854843 11:15198705-15198727 CTAGAAATGACCAGCAGGGCTGG + Intronic
1083396586 11:62396636-62396658 CTAGAGCTGTCCATGTGTGCTGG - Intergenic
1083987778 11:66227985-66228007 CTGGAGCTGCCCAGGAGTGCAGG + Intronic
1083996774 11:66276805-66276827 CTCGAGCCGTCCAGCTGCGGTGG + Exonic
1084494081 11:69494112-69494134 GGTGAGCTGTCCAGCAGCGTGGG + Intergenic
1085739746 11:79068798-79068820 CTTGAGCAGTTCAGCAGGGCTGG + Intronic
1087099062 11:94347660-94347682 CTAGAGCTGTAAAGCATCTCAGG - Intergenic
1089571688 11:119415559-119415581 CTGGAGGTGCCCAGCAGTGCAGG - Intergenic
1089792453 11:120954636-120954658 CTAGAGCTTTCAACCAGCCCTGG + Intronic
1090771307 11:129921862-129921884 GTGGAGCTGGCCAGCAGGGCTGG - Intronic
1091675159 12:2483923-2483945 CTACTGCTGTCCTGGAGCGCTGG - Intronic
1099836133 12:87911158-87911180 CTAGAGCTGTAAAGCATCTCAGG + Intergenic
1100180064 12:92075509-92075531 CTAGAACTGTCCAGAAGCTCAGG - Intronic
1111224490 13:85251943-85251965 CTAGAGATGTCCAGGATGGCTGG - Intergenic
1113472977 13:110559843-110559865 CAAGAGCTGCCCTGCAGTGCTGG - Intronic
1121405929 14:93719458-93719480 CTTGGGCTGTCCAGAAGCTCAGG - Exonic
1122669024 14:103355697-103355719 AAAGAGCTCTCCAGCAGCCCAGG - Intergenic
1125525665 15:40372639-40372661 CTAGAGCTGCTCATCAGCCCTGG + Intergenic
1130508821 15:84571153-84571175 CTAGATGGGTCCAGCAGTGCTGG - Intergenic
1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG + Intronic
1131888652 15:96948028-96948050 CGAGAGCCGGGCAGCAGCGCGGG - Intergenic
1137448788 16:48551307-48551329 GTGGACCTGTCCAGCAGAGCAGG + Intronic
1145079625 17:19883970-19883992 CTGGAGCTGGCCAACAGTGCTGG - Intergenic
1147455365 17:40534653-40534675 CTCGAGGTTTCCAGCAGAGCAGG - Intergenic
1147754727 17:42760990-42761012 CGGGAGCTGTCCAGCCTCGCGGG + Intronic
1151210223 17:72538917-72538939 CTAGAGGTGCCCTGCTGCGCTGG + Intergenic
1152441214 17:80311406-80311428 CTAGAACAATCCAGCAGCACAGG - Intronic
1152692868 17:81728425-81728447 CTAGAGCTGGCCAGGTGCGGTGG - Intergenic
1160681927 19:415818-415840 CTAGACCTGTCCCCCAGGGCAGG + Intergenic
1163112528 19:15170208-15170230 CTAGAGGTGTCCAGCTGGGAAGG + Intronic
1163641474 19:18464884-18464906 CCAGAGCTTTCCTGCAGTGCTGG + Intronic
1165169813 19:33884056-33884078 CCAGGGCTGTGCAGCAGGGCAGG - Intergenic
1166310916 19:41962202-41962224 CTGGAGGTGTCGAACAGCGCAGG + Intergenic
925114884 2:1370056-1370078 CTGGAGCTGGCCAGGAGCCCAGG + Intergenic
926357768 2:12056971-12056993 CTAGAGCTGTCCCCCAGGCCAGG - Intergenic
929299469 2:40286678-40286700 ATATAGCTGTCCATCAGCTCCGG - Intronic
929994609 2:46817475-46817497 CTGGAACTGTCCAGCAACCCTGG + Intronic
934158867 2:89229451-89229473 CTAGAGCTATCCATCAGCACAGG + Intergenic
934208407 2:89952977-89952999 CTAGAGCTGTCCATCAGCACAGG - Intergenic
937066306 2:119020497-119020519 CTAGAGATGTCCAGCATAGATGG - Intergenic
942646065 2:178112397-178112419 CAGGCGCTGTCCAGCCGCGCAGG - Intergenic
947794761 2:232887333-232887355 CTAGAGGTTTGCAGCAGAGCAGG - Intronic
948541667 2:238695364-238695386 GTGGGGCTGACCAGCAGCGCTGG + Intergenic
948549611 2:238761498-238761520 TTAGGGCTGTCCAGCAGCAGGGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171263827 20:23754335-23754357 CTAGAGGAGTCCAGCTGCCCAGG + Intergenic
1173331311 20:42078268-42078290 CTGGAGCTGTCCAGAAGTCCAGG - Exonic
1173846636 20:46192747-46192769 TTAGAGCTGGCCAGCTGGGCAGG + Intronic
1180707495 22:17818381-17818403 AGGGAGCTGTCCAGCAGCTCTGG - Exonic
1181463221 22:23097384-23097406 CTAGAGCTGTCCAGGTTCCCTGG - Intronic
1184336175 22:43854561-43854583 CTAGAGGTCACCTGCAGCGCTGG + Intronic
1185036249 22:48478678-48478700 CCAGAGCTGTCCAGAAGCACTGG - Intergenic
950728373 3:14934655-14934677 CTAGAGCTGTTGAGCAGAGCAGG + Intergenic
952663495 3:35878088-35878110 CTAGGGCTGTCAAGCATCTCAGG + Intergenic
954447471 3:50554344-50554366 CTGGGGCCGTCCAGCAGCTCAGG + Intergenic
972739797 4:41878742-41878764 CTAGAATTTTCCACCAGCGCTGG + Intergenic
981755988 4:148142347-148142369 CTAGAGCTGTCCGTCAGGTCTGG - Intronic
984220231 4:176965458-176965480 CTAGAGATGGCCAGGAGCGGTGG - Intergenic
988907312 5:35802738-35802760 CTAGGGCTAGCCAGCAGAGCTGG + Intronic
990743849 5:58938150-58938172 CTAGAGGAGTCTAGCACCGCTGG + Intergenic
993057742 5:83001842-83001864 GTAAAGCTGGGCAGCAGCGCTGG + Intergenic
997707539 5:135972072-135972094 CTAGAGCTGTGCAGGTGCTCAGG - Intergenic
1003078817 6:3004572-3004594 CTCCAGCTGTCCAGGAGCACAGG - Exonic
1004350449 6:14886019-14886041 CTAGAGAGATCCAGCAGGGCTGG + Intergenic
1005658582 6:27968562-27968584 TTAGAGCTATTCAGCAGCCCTGG - Intergenic
1007281304 6:40714320-40714342 CCAGTGCTGGACAGCAGCGCAGG + Intergenic
1017036791 6:150274244-150274266 CTCGAGCTGTCCAGCTTGGCAGG + Intergenic
1023972536 7:45001711-45001733 CTAGAGCTGTCTATCAGCTTTGG + Intronic
1026589744 7:71684433-71684455 CTACAGCTGACCCGCAGCCCAGG + Intronic
1031071757 7:117169698-117169720 CTAGCGGTGGCCAGCAGCCCAGG - Intronic
1032279958 7:130492223-130492245 GCAGAGCTGGCCAGCAGCGGGGG - Exonic
1035463001 7:159056873-159056895 CTAGAGCTGCACACCAGCTCTGG + Intronic
1036604736 8:10295061-10295083 CTAGATCTGTCCTGCCGCCCAGG - Intronic
1044804571 8:95991958-95991980 CTGGAGCTTTCCAGCAACGGTGG + Intergenic
1053567305 9:39266928-39266950 TCAGAGCTGTCCAGCAGCCACGG - Exonic
1053833030 9:42104661-42104683 TCAGAGCTGTCCAGCAGCCACGG - Exonic
1054129838 9:61352070-61352092 TCAGAGCTGTCCAGCAGCCACGG + Intergenic
1054597521 9:67082748-67082770 TCAGAGCTGTCCAGCAGCCACGG + Intergenic
1061908846 9:133712363-133712385 CCAGAGCTGTCCAGGGGCTCAGG + Intronic
1062339281 9:136086757-136086779 CTGGAGCTGGCCAGCTGCACTGG + Intronic
1062538772 9:137032325-137032347 CCAGAGATGTCCAGCTGGGCAGG + Exonic
1185449691 X:275682-275704 CTGGAGCTGACCAGGAGCCCAGG - Intergenic
1192173771 X:68873418-68873440 CTAGAGCTGTCCTGGGGCTCTGG - Intergenic