ID: 1131021201

View in Genome Browser
Species Human (GRCh38)
Location 15:89100561-89100583
Sequence AGGTTCCTTTTTAACATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131021201_1131021207 24 Left 1131021201 15:89100561-89100583 CCTTAGATGTTAAAAAGGAACCT 0: 1
1: 0
2: 2
3: 25
4: 191
Right 1131021207 15:89100608-89100630 GCCTGTAATCCCAGCACTTTCGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1131021201_1131021209 27 Left 1131021201 15:89100561-89100583 CCTTAGATGTTAAAAAGGAACCT 0: 1
1: 0
2: 2
3: 25
4: 191
Right 1131021209 15:89100611-89100633 TGTAATCCCAGCACTTTCGGAGG 0: 2099
1: 301438
2: 269274
3: 150602
4: 138910
1131021201_1131021204 -4 Left 1131021201 15:89100561-89100583 CCTTAGATGTTAAAAAGGAACCT 0: 1
1: 0
2: 2
3: 25
4: 191
Right 1131021204 15:89100580-89100602 ACCTTATTGGCCAGGCAAAGTGG 0: 1
1: 4
2: 19
3: 223
4: 1667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131021201 Original CRISPR AGGTTCCTTTTTAACATCTA AGG (reversed) Intronic
905155541 1:35976663-35976685 AGATGCCTTTTCAGCATCTATGG + Intronic
905781252 1:40711971-40711993 AGGTTCCATTTTTACATGTGAGG - Intronic
905855718 1:41311265-41311287 ACATTCATTTTTAATATCTATGG - Intergenic
907143599 1:52211806-52211828 ATTTTCTTTTTTAAAATCTATGG + Intronic
907921002 1:58911604-58911626 ATTTTCCTTTTACACATCTATGG + Intergenic
911664059 1:100534391-100534413 AGCTTCCTTTTTAAGATTTCAGG - Intergenic
914359447 1:146920216-146920238 AGGTTGATATTTAACATATAGGG + Intergenic
914494303 1:148179659-148179681 AGGTTGATATTTAACATATAGGG - Intergenic
916308899 1:163372033-163372055 AAGTTCATTTTTAAAATATAAGG - Intergenic
916388928 1:164308890-164308912 AGTTTTCTTTTTGACATGTAAGG + Intergenic
916987864 1:170210925-170210947 AAGAGACTTTTTAACATCTAAGG + Intergenic
918164159 1:181928461-181928483 GGGTTCCTTTTTAAAAACCATGG + Intergenic
918652031 1:186977231-186977253 AGATTCCTTTTTTACTCCTAAGG + Intronic
920844589 1:209583299-209583321 AGTTTCCTTTTTAACCCCTCAGG - Intergenic
921611029 1:217212760-217212782 ATTTTACTTTTTAACATCAAAGG - Intergenic
1062777510 10:165483-165505 AGGTGTCTTTTAGACATCTAAGG - Intronic
1063275930 10:4567984-4568006 AGATTCCTTTTTAGCAAGTATGG - Intergenic
1064897105 10:20249684-20249706 AAGTTCCTTTTTACCGTGTAAGG + Intronic
1065370770 10:24982887-24982909 AGTTTTCATTTTAACATTTAAGG + Exonic
1065961423 10:30737216-30737238 AGGTTCTTTTTTGACCTCTCTGG - Intergenic
1067752316 10:48979725-48979747 AGGTTCCTATTCAGCATCAATGG + Intronic
1068037711 10:51781968-51781990 ACTTTTTTTTTTAACATCTAAGG - Intronic
1069354663 10:67570793-67570815 TGGTTTCTTTTTCACATCTTTGG + Intronic
1070654934 10:78264925-78264947 AGGGTCATTTTTATCATCTTGGG - Intergenic
1071184025 10:83019707-83019729 AGTTTCCTGTTTAGCAACTACGG - Intergenic
1073579436 10:104650851-104650873 AGAAGCCTTTTTGACATCTATGG + Intronic
1075190299 10:120300958-120300980 AGGTTCCTTTTTTATATTTATGG - Intergenic
1077005104 11:351313-351335 AGGGTCCCTTTTAAGATTTAGGG - Intergenic
1078970716 11:16407812-16407834 AGTTTCCTTTTTAATATCTTTGG - Intronic
1083021436 11:59511466-59511488 AGGTTGCTTTTTCCCATCTGAGG + Intergenic
1083851631 11:65371047-65371069 AGGTGCCTTTGGGACATCTAAGG + Intergenic
1084896079 11:72270095-72270117 AGCTTCCTTTTAACCATTTATGG + Intergenic
1086775630 11:90829169-90829191 AGGTTCTTTTTGAACATATTTGG + Intergenic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1093774520 12:23057014-23057036 AAGTTCCTTCTTATAATCTATGG + Intergenic
1097824736 12:64163388-64163410 ATGTACCTTTTTAACATTCAGGG - Intergenic
1098298495 12:69028905-69028927 AGGTTCTTTCCTAACATTTATGG + Intergenic
1098903193 12:76133880-76133902 ACATTCCTTTTTAGCATCCATGG - Intergenic
1099454548 12:82848021-82848043 AGATGCCTTTTCAACTTCTAAGG + Intronic
1101712455 12:107281345-107281367 ACCTTCATTTTTAACATTTATGG + Intergenic
1103753132 12:123181035-123181057 AGGTTCCAGTTCAACAGCTACGG + Intronic
1105431031 13:20338066-20338088 CGCTGCCTTTCTAACATCTAGGG + Intergenic
1106330799 13:28737733-28737755 TGGGTACTTTTTAACATCTAGGG + Intergenic
1106345200 13:28870269-28870291 GGATTCCTTCTTAAGATCTAAGG - Intronic
1106372831 13:29153271-29153293 AGGTTCTTTTTTAACTTCTGAGG - Intronic
1107027299 13:35815597-35815619 AATTTACTTTTTAACATATACGG + Intronic
1108649487 13:52462110-52462132 AGGTTGCTTTTTAAAATCTAAGG + Intronic
1109579018 13:64301524-64301546 AGTTTTCTTATTAACATCTTTGG - Intergenic
1109994442 13:70105587-70105609 AGTTTCCTTTTGAATATATAAGG + Intronic
1111155906 13:84325054-84325076 AGATTCCTTTGTAGCATCTAAGG + Intergenic
1111798970 13:92959419-92959441 AGGTTCCTCCATAACATGTAGGG + Intergenic
1111832503 13:93347083-93347105 ATGTTCTTTTTGAACATGTAGGG + Intronic
1112931029 13:104738457-104738479 ACATTTGTTTTTAACATCTAGGG - Intergenic
1113316898 13:109190210-109190232 AGGTTTGTTTTTTACATTTAGGG + Intronic
1113837059 13:113335165-113335187 AGGTTTATTTTTAATATTTATGG + Intronic
1115025507 14:28740507-28740529 AGGTTGCTTTTTTTCATCTTTGG + Intergenic
1115040281 14:28916213-28916235 CCATTCCTTTTTAACATTTAAGG + Intergenic
1115446709 14:33498871-33498893 AGGTTTATTTTTAAAATCTGGGG + Intronic
1115983126 14:39075938-39075960 AGTTCCCTTTTTAACATATTTGG + Exonic
1116410267 14:44612788-44612810 AGGTGCTGTTTTAACATCTCAGG - Intergenic
1119927781 14:78512766-78512788 AGGTTCCTTTTTTATCTCTTAGG - Intronic
1120115667 14:80614507-80614529 ACTTTTCATTTTAACATCTAGGG + Intronic
1120929759 14:89836579-89836601 AGGTTCATGTGGAACATCTATGG - Intronic
1121691502 14:95880759-95880781 GGCTTCCCTTGTAACATCTAAGG + Intergenic
1125095112 15:35841733-35841755 AAATTCCTTTTTAAGATCTCTGG + Intergenic
1127412609 15:58724262-58724284 AGGTTCATTTTAAATATTTAAGG + Intronic
1131021201 15:89100561-89100583 AGGTTCCTTTTTAACATCTAAGG - Intronic
1131510308 15:93046106-93046128 AGGGTCCCTTTTGCCATCTAAGG - Intronic
1131726561 15:95232501-95232523 ATCTTCCTTTTTAATATCTAGGG - Intergenic
1133592758 16:7262016-7262038 TGGTTCCTTTTTCACATTTATGG + Intronic
1134890054 16:17832982-17833004 ATGTTCCTCTTTAGCATGTATGG - Intergenic
1135876687 16:26207110-26207132 AGGTTACCTCTTAACATCTACGG - Intergenic
1139339396 16:66258188-66258210 GAGTTCCTTTTTACCATGTAAGG - Intergenic
1142944830 17:3416205-3416227 AAATGCCTTTTTAGCATCTATGG + Intergenic
1143237073 17:5412091-5412113 AGGTTCTTTTTTAAAATATGTGG - Intronic
1143433117 17:6901469-6901491 ATGTTCCTTTTAAAAATATATGG - Intronic
1146387132 17:32387351-32387373 ATGTTACTTTTAAAAATCTAAGG + Intergenic
1149410214 17:56397203-56397225 GTGTTCCTGTTTAACATCTGAGG - Intronic
1150118091 17:62572896-62572918 TGATTCCTTTTTAACAGCTAAGG - Intronic
1153070065 18:1095491-1095513 ATGTTCATTTTAAACATCCAAGG - Intergenic
1154962329 18:21321801-21321823 AAGTGCCCTTTTGACATCTATGG - Intronic
1155945692 18:31847858-31847880 AGGTTAGTTTTAAAAATCTAAGG - Intronic
1156650529 18:39221089-39221111 GGGTTCTTTTTCAACATCCAGGG + Intergenic
1156876946 18:42025766-42025788 ATATTCATTTTTTACATCTAAGG - Intronic
1157114039 18:44846558-44846580 AGATTCTTTTTTAACATATAAGG - Intronic
1158809834 18:61019814-61019836 AGATTCCTTGTTAACCTCAAGGG + Intergenic
1160559726 18:79748606-79748628 AGGTTTCTTGTGAAAATCTAAGG + Intronic
1164219788 19:23183332-23183354 AGTTTTCTTTTTAATATCTGGGG + Intergenic
1165530768 19:36398642-36398664 AGTTACCTTTTCAGCATCTATGG - Intronic
1166145036 19:40828267-40828289 AAGGTCCTTTTTACCATGTAAGG - Intronic
1168361631 19:55745616-55745638 AGGTTCTTTTTTAACTCCTCAGG + Intergenic
925350379 2:3197167-3197189 AGGTTCATTTTTGCCATTTAAGG - Intronic
929137491 2:38638459-38638481 AGGTCCATTTTTTACATTTAGGG - Intergenic
929184125 2:39075376-39075398 AGGTTCTTGTATTACATCTAGGG + Intronic
930584785 2:53256260-53256282 ATGTTTCTTTTTAACCCCTAAGG - Intergenic
931095597 2:58937336-58937358 AGGTTTCTATTTAAAATTTAGGG - Intergenic
931472888 2:62557133-62557155 AAATTCCTGTTTAACATCTGGGG - Intergenic
931604660 2:64040979-64041001 AGGTTATTTTTTAAAATCTTTGG + Intergenic
931970495 2:67580393-67580415 AGATTCATTTTTATCATCTTGGG - Intergenic
933728382 2:85438842-85438864 AGGTTCCTTTTTGCCCTCAAGGG - Intergenic
934575909 2:95401528-95401550 AGGTTCCATTTCAATATCTGTGG + Intergenic
935909800 2:107883021-107883043 AGCTGACTTTTTAACATCTTGGG + Intronic
936776752 2:115984019-115984041 AGGTACCTTTTTTACATCTGTGG + Intergenic
937600812 2:123729588-123729610 AGGCTCCATTTTAATTTCTAAGG - Intergenic
938161025 2:128984618-128984640 AGGTGCTTTTTCAACATATAAGG + Intergenic
938404492 2:131022611-131022633 AGGTTCATTTTCATCACCTATGG - Intronic
938865768 2:135418449-135418471 AGGTTTTTTTTTAAAATCTAGGG + Intronic
940013483 2:149079430-149079452 AGGTTCCTTTTTATTTTCTGTGG + Intronic
942003416 2:171673777-171673799 AGTTTCTTTTTTCACATCTGGGG - Intergenic
942674164 2:178410164-178410186 AGGTTCCTTGAAAACTTCTATGG + Intergenic
943574028 2:189609748-189609770 AGGTGCCTCTATAACATCTCAGG - Intergenic
944982702 2:205139926-205139948 AGGTTCCTCTTTAACCTGTAGGG + Intronic
945940595 2:215945718-215945740 AGCTTCCTTTTGAAAACCTAAGG + Exonic
946292867 2:218758937-218758959 CTGTTCCTTTTTTATATCTAAGG - Intergenic
947053369 2:226072613-226072635 AGCATTTTTTTTAACATCTATGG + Intergenic
947392311 2:229651757-229651779 ATGTTCCTTTTTGAAATCCAGGG - Intronic
1168901418 20:1368330-1368352 AATTTCCTTTTTAAAATCAATGG + Intronic
1173487444 20:43451689-43451711 CGGTTGCTTTTGAACATCAATGG - Intergenic
1173638084 20:44578518-44578540 AGGTTCTTTTTAAACAACCAGGG - Intronic
1174673743 20:52333178-52333200 AAGTTCCTTTGTACCATATAAGG + Intergenic
1177110612 21:17023233-17023255 AGGTACTTTTTGAACATTTAGGG - Intergenic
1178435942 21:32558576-32558598 AGGGTCCCTTTTAAGATTTAAGG - Intergenic
1178609686 21:34070074-34070096 AGGTTCCTTTTTTACAAATAGGG + Intergenic
1183064846 22:35355786-35355808 AGGGTCCTTTGTGACATCTTGGG - Intergenic
951782482 3:26379664-26379686 AGTTTCCTCTCTAACATCTTAGG - Intergenic
951877667 3:27445238-27445260 AGGATCCTTTTTCAGATCTTTGG + Intronic
955401992 3:58598769-58598791 AGCTTCCTTTTTAAACTCTGTGG + Intronic
956418879 3:69064706-69064728 AGTTTCCTTTTTAGCCTCCAGGG - Intronic
957415366 3:79895306-79895328 AGGTTCCTGTTTAACAGCACTGG + Intergenic
958896298 3:99833335-99833357 AGGTTTCTTTTGAGAATCTATGG - Intronic
961540990 3:127599241-127599263 AGCTTCCTTTTTACCATCAGGGG - Intronic
964266145 3:154897746-154897768 TGGTACCATTTTAAGATCTATGG - Intergenic
964566080 3:158054482-158054504 AGGTACCTTTTCAACATCACAGG + Intergenic
964796317 3:160501575-160501597 AGGTTCATCTTTGAAATCTAGGG - Exonic
965454296 3:168878531-168878553 AGTTTCCTTTTTCATATCTCTGG + Intergenic
966883028 3:184360601-184360623 TGGTTCCTTTTTACCAGCTTGGG - Intronic
969943987 4:10764136-10764158 AGAGTCCTTTTTGCCATCTAAGG + Intergenic
970803169 4:20000871-20000893 AGAAACCTTGTTAACATCTAGGG + Intergenic
971091049 4:23346243-23346265 AGGTTCCTTTGAAACATTAAAGG + Intergenic
971824656 4:31605282-31605304 GGGTTTCTGTTTAACACCTATGG + Intergenic
973095462 4:46192655-46192677 AGGCTCATTTTTATCATCGATGG + Intergenic
976500734 4:85786014-85786036 AGGCTTTTTCTTAACATCTATGG + Intronic
978433918 4:108662838-108662860 AGGTTCATTTTTAGCAAATAAGG + Intronic
978628184 4:110711610-110711632 ACGTTCCCTTTTAACATTTTTGG + Intergenic
979490924 4:121326829-121326851 AGGTTCCTTTTGCAAATCCAGGG + Intergenic
987532311 5:19137624-19137646 AGCTTACTTACTAACATCTAAGG - Intergenic
987881685 5:23754724-23754746 AAGTTGCTTTTTTACATTTATGG + Intergenic
988477357 5:31598571-31598593 AGATTCATTTTTAATATTTATGG - Intergenic
990687225 5:58318645-58318667 ATGTTCCTTTTTAGCATGTGGGG + Intergenic
992047574 5:72909693-72909715 AAGTTCCTTTTTAAGATTTGTGG + Exonic
993634550 5:90327491-90327513 AAATTCATTTTTAAAATCTAAGG + Intergenic
993873206 5:93275807-93275829 AGTGTAATTTTTAACATCTAAGG + Intergenic
994001528 5:94787207-94787229 ATGTTTCTTTTAAATATCTATGG + Intronic
995553464 5:113303130-113303152 AGATTCCTATTTGACATCTAAGG + Intronic
997015568 5:129930478-129930500 TGCCTCCTTTTAAACATCTATGG - Intronic
999979260 5:156942238-156942260 AGGTTCCTTATTTACATATGAGG - Intronic
1001024160 5:168209228-168209250 AGTTTCCTTTTTAATATCTCTGG + Intronic
1002565276 5:180109539-180109561 AGGTTCCTTTTTGCCATAGAAGG - Intronic
1003292091 6:4788547-4788569 GGGTTCCTTTTCAAACTCTAAGG - Intronic
1003432810 6:6055610-6055632 AGTTTCCCTTTTAGCAGCTATGG - Intergenic
1004980294 6:21016022-21016044 AGGTTCCATCTTAACTTTTATGG + Intronic
1005079449 6:21942178-21942200 GGGCTCCTTTTTAACATCTTAGG + Intergenic
1005395790 6:25380670-25380692 TTCTTCCTTTTTAAAATCTAAGG + Intronic
1011104840 6:83768195-83768217 GGCTTCATTTTTAGCATCTAGGG - Intergenic
1011242961 6:85291635-85291657 AGGTTCGTCTTTAAAATCTAGGG + Intergenic
1013569474 6:111407396-111407418 GGTTTACATTTTAACATCTATGG - Intronic
1014770828 6:125456303-125456325 AAGTTCTTTTCTAACACCTATGG - Intergenic
1019286803 7:227469-227491 ATGTTTTTTTTAAACATCTAGGG + Intronic
1020431005 7:8116131-8116153 AATTTCCATTTGAACATCTAGGG - Intronic
1020544166 7:9502256-9502278 AGGTTATTTTTTAACTTCTTTGG - Intergenic
1021414464 7:20366155-20366177 ATGTTCCTTTCTAACATCTATGG + Intronic
1022814337 7:33900023-33900045 AGGTTGATATTTAACATGTATGG - Intergenic
1022871595 7:34486055-34486077 ATGTTCCTTCTTGACATCTGGGG - Intergenic
1023705529 7:42937579-42937601 AGTTACCCTTTTAACATCTTTGG - Exonic
1023729783 7:43179933-43179955 AGGTTCCTGTATAACATCCCTGG - Intronic
1024494039 7:50022630-50022652 TGGTTTCTATTTGACATCTACGG + Intronic
1031520211 7:122755600-122755622 AGGACCATTTTTAACATCTGGGG - Intronic
1031547932 7:123072868-123072890 ATGTTTCTTTTAAACATATAAGG + Intergenic
1031624424 7:123975771-123975793 AGGTTCCTTATAAACATGTCTGG - Intergenic
1032766984 7:135004162-135004184 AAATGCCTTTTTAACATCTATGG + Intronic
1033739008 7:144254288-144254310 AGGTTCTTTTTTAAAATCTTGGG + Intergenic
1033744037 7:144296666-144296688 AGGTTCTTTTTTAAAATCTTGGG - Intergenic
1036974340 8:13394153-13394175 ATGTTCCTATTCAACCTCTATGG + Intronic
1038980586 8:32755085-32755107 AGATTCCTTTTTTACATCTCAGG - Intronic
1039126257 8:34205205-34205227 ATTTTCCTTTTTCACCTCTACGG + Intergenic
1042811515 8:72830593-72830615 ACATTCCATTTTAATATCTATGG + Intronic
1044800769 8:95952213-95952235 ACCTTTCTTTTTGACATCTATGG - Intergenic
1044914948 8:97103180-97103202 AAGTTCCTTTTTGCCATATAAGG + Intronic
1045049583 8:98310572-98310594 AGGTTGCTTATTTACATCTCAGG + Intergenic
1046026088 8:108725835-108725857 AGATTTATTTTTCACATCTAAGG + Intronic
1050245428 9:3684598-3684620 AAGGTCCTTGTCAACATCTAGGG - Intergenic
1051036628 9:12754493-12754515 AGGTTTCTTTGGAACATTTAGGG + Intergenic
1051510175 9:17868805-17868827 AAGTACATTTTGAACATCTATGG + Intergenic
1051796886 9:20881740-20881762 AGGTCTCTTTTTACCATGTAAGG + Intronic
1052032899 9:23648688-23648710 AGAATCCTTTTTAACATATAAGG - Intergenic
1052111593 9:24591687-24591709 AGGTGCCTTTTTGCCAACTATGG + Intergenic
1052228813 9:26122073-26122095 AGGTTCCTTTTCAATATTTCAGG - Intergenic
1055425270 9:76188924-76188946 AGGTTCCATTTTAACTTTGAAGG + Intronic
1055525803 9:77132639-77132661 AGGTCCCTCTTTAACATGTGGGG - Intergenic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1057186824 9:93061777-93061799 AGGTTCCTGTTTCACATTTGGGG + Intronic
1057922952 9:99113824-99113846 ATGTTCCATTTTGACAGCTATGG - Intronic
1058610438 9:106770089-106770111 AGGTTCTTTTATTACTTCTAAGG - Intergenic
1058684037 9:107465354-107465376 AGGTTCCTTTTCTACCTCAAAGG + Intergenic
1059185966 9:112271129-112271151 AGGTTCCTTTTTAAGTACTGAGG + Intronic
1062678706 9:137764121-137764143 TGGATCCTGTTTAACACCTACGG - Intronic
1185664626 X:1755848-1755870 TGTTTCTTTTTTGACATCTATGG - Intergenic
1186773750 X:12843430-12843452 GGGTTTCTTTTTCATATCTAAGG - Intergenic
1188011554 X:25061657-25061679 AGTCTCCTTTTCAACATCTTGGG - Intergenic
1188059077 X:25577803-25577825 ATTTTCCTTTTTTACATGTAAGG - Intergenic
1189682384 X:43529905-43529927 AAGTTCCTTTTTGCCATCTAAGG - Intergenic
1189892391 X:45617696-45617718 AGGTTCTTTTTTATCATGAAGGG + Intergenic
1190143506 X:47869133-47869155 AGATTCCTTTTTTCCCTCTAAGG + Intronic
1195305010 X:103573471-103573493 AGTTTCCTCTTCAACATCCAAGG - Intergenic
1196180343 X:112682826-112682848 AGTTTCCTTTTTGACCTCGAAGG + Intergenic
1197016890 X:121635756-121635778 ATGGGCCTTTTTAACATGTAAGG - Intergenic
1198320156 X:135512441-135512463 AGTTTCCCTTTTAACTTCTGGGG - Intergenic
1201369670 Y:13248860-13248882 AGTTTTATTTTTTACATCTATGG - Exonic