ID: 1131022676

View in Genome Browser
Species Human (GRCh38)
Location 15:89112531-89112553
Sequence GACAGATAATAATTGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131022669_1131022676 23 Left 1131022669 15:89112485-89112507 CCTCACCACAGCCTGGTCCTCTA 0: 1
1: 0
2: 3
3: 25
4: 253
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186
1131022671_1131022676 12 Left 1131022671 15:89112496-89112518 CCTGGTCCTCTATGACTAATTTG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186
1131022666_1131022676 28 Left 1131022666 15:89112480-89112502 CCCCACCTCACCACAGCCTGGTC 0: 1
1: 0
2: 0
3: 66
4: 561
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186
1131022670_1131022676 18 Left 1131022670 15:89112490-89112512 CCACAGCCTGGTCCTCTATGACT 0: 1
1: 0
2: 2
3: 16
4: 221
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186
1131022672_1131022676 6 Left 1131022672 15:89112502-89112524 CCTCTATGACTAATTTGTCTCAG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186
1131022667_1131022676 27 Left 1131022667 15:89112481-89112503 CCCACCTCACCACAGCCTGGTCC 0: 1
1: 0
2: 0
3: 39
4: 418
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186
1131022668_1131022676 26 Left 1131022668 15:89112482-89112504 CCACCTCACCACAGCCTGGTCCT 0: 1
1: 0
2: 3
3: 48
4: 515
Right 1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131022676 Original CRISPR GACAGATAATAATTGGAAGC TGG Intronic
902101252 1:13991671-13991693 AACAAGTAATAATTGTAAGCTGG + Intergenic
904994080 1:34617368-34617390 GACAGACAATCATGGGAAGAGGG + Intergenic
905516048 1:38562899-38562921 AACAGATGAGACTTGGAAGCAGG - Intergenic
906464797 1:46068240-46068262 CACATACAATAATTGCAAGCTGG + Intronic
907492139 1:54815017-54815039 GCCAGATGATTATGGGAAGCTGG + Exonic
907645850 1:56242629-56242651 GACAAATAATAATTGTAGGCTGG - Intergenic
908457329 1:64316522-64316544 GACAGATAAAAATTGTAGGCTGG + Intergenic
909337319 1:74490771-74490793 GACAGAAAGTATTTGAAAGCAGG + Intronic
909611270 1:77554137-77554159 GGCAGATAAAAAGAGGAAGCTGG - Intronic
909632675 1:77784147-77784169 GACACAAAATAATTAAAAGCAGG - Intronic
909960412 1:81833710-81833732 TGCAGCTAATAAATGGAAGCAGG + Intronic
911790087 1:102003892-102003914 GTCAACTAATAATTGGAATCCGG + Intergenic
911812215 1:102296903-102296925 GACAGATAATGAGTGTAACCAGG - Intergenic
913676944 1:121149845-121149867 TACAGAAAAGAATTGGAGGCCGG + Intergenic
916480543 1:165210672-165210694 GACAGATAAAAGTAAGAAGCAGG + Intronic
917044067 1:170837233-170837255 GACAGATGATATTAGAAAGCTGG - Intergenic
919300340 1:195754990-195755012 GACAGATAATAATTGGCACCTGG + Intergenic
920026635 1:203003179-203003201 CACAGATAATAAATGGCAGAGGG + Intergenic
921424577 1:214986490-214986512 TACAGAAAAGAATTGAAAGCAGG - Intergenic
922885804 1:229019679-229019701 GACAGAAACAAATAGGAAGCAGG + Intergenic
923241634 1:232090610-232090632 GAAAGATAACAGCTGGAAGCTGG - Intergenic
923400218 1:233609591-233609613 TACCCAAAATAATTGGAAGCAGG - Intergenic
924051045 1:240079860-240079882 GACAGAAAAAGAATGGAAGCTGG + Intronic
924920186 1:248620826-248620848 AACACACAACAATTGGAAGCAGG - Intergenic
1064490948 10:15856510-15856532 GAAGGAAAATAATTGGAAGAAGG + Intronic
1065391956 10:25191915-25191937 GACAGATAATAACAGGAGGCAGG - Intronic
1067739722 10:48886034-48886056 GGCAGATGATAAATGGGAGCAGG + Intronic
1067859799 10:49834043-49834065 GACAGATATTAATTATAAGTTGG + Intronic
1070120902 10:73575794-73575816 CACAGATGATATTTGGAAGGTGG - Intronic
1072372905 10:94783458-94783480 TACAGATAAGAATTGGAATTTGG + Intronic
1074428453 10:113372567-113372589 CACAGAAAAGAATGGGAAGCAGG - Intergenic
1074733823 10:116407055-116407077 TACGCAAAATAATTGGAAGCAGG - Intergenic
1074883591 10:117677620-117677642 GAAAGATGATAGTTAGAAGCCGG + Intergenic
1080581558 11:33648549-33648571 GCCAGAAGATAATTGGAAGCTGG + Intronic
1080848105 11:36044129-36044151 CACAGGTCATAAATGGAAGCTGG - Intronic
1081711059 11:45215697-45215719 GACAGAAATGAATTGGAAGAGGG + Intronic
1085707676 11:78801221-78801243 GATAGAAAAGAGTTGGAAGCGGG - Intronic
1086251640 11:84822335-84822357 GGCAAATGATAATTGGAAGGAGG + Intronic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1096817701 12:54211733-54211755 GACAGGAAATAAGTGGAAGAGGG - Intergenic
1097514635 12:60589489-60589511 GACAGATAATAAATTGATGCAGG + Intergenic
1100791455 12:98134608-98134630 GAGAGAGAATGATTGTAAGCAGG - Intergenic
1101721148 12:107351821-107351843 AACAGATATTAATTGGGAGAGGG - Intronic
1101936656 12:109063534-109063556 TACAGAAAATAACTGAAAGCAGG - Intronic
1102580374 12:113882636-113882658 GACTGAGAATTATGGGAAGCGGG + Intronic
1103004130 12:117408275-117408297 GTCAGAGAGGAATTGGAAGCAGG - Intronic
1105569386 13:21586955-21586977 GACAAATAATAATGGGAAAGAGG - Intronic
1107461907 13:40612219-40612241 GACAGCTGATAAATGGAAGATGG - Intronic
1110287403 13:73765776-73765798 GACAGACCATAACAGGAAGCTGG - Intronic
1110592082 13:77275016-77275038 GAAGGATAATAATTGGAGGAAGG - Intronic
1111306434 13:86419142-86419164 AACAGGTAATAAATGGAAACAGG - Intergenic
1111448196 13:88378263-88378285 GACACATAAGATTTGGTAGCTGG + Intergenic
1117549053 14:56816509-56816531 GACAATTAATAATGAGAAGCAGG + Intergenic
1118329302 14:64803352-64803374 GATAGAAATTAATTGGTAGCTGG - Intronic
1119733108 14:76963681-76963703 GAGACATAATAAATGGAAGTGGG + Intergenic
1122897289 14:104765840-104765862 GACACAAAATAATTGACAGCAGG + Intronic
1124243105 15:28047379-28047401 GACAGATAATCATGCCAAGCTGG - Intronic
1125162390 15:36660871-36660893 AACAGATAAAACTTGGAATCTGG - Intronic
1126824923 15:52539523-52539545 GAGAGAGAATAAGTGCAAGCAGG + Intergenic
1127602389 15:60551310-60551332 GACAGATAACAAGCAGAAGCCGG + Intronic
1128942261 15:71798634-71798656 AAAAGAAAATAATTGGAAGATGG - Intronic
1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG + Intronic
1133404978 16:5516337-5516359 GACAGAAAATAATGGGAGACAGG - Intergenic
1134383744 16:13752400-13752422 GACAAATATTTATTGGAAGGAGG + Intergenic
1136751444 16:32638824-32638846 AACAAAAAATAATTGGAAGAAGG + Intergenic
1137768240 16:50994331-50994353 CACAGATAATAAATGGCAGTGGG + Intergenic
1138181934 16:54946556-54946578 GACAATCAATAAATGGAAGCTGG + Intergenic
1139127815 16:64101445-64101467 GACACATAATAATTGTAAATTGG - Intergenic
1141261607 16:82459486-82459508 GACAGATTATAAGTAGAAGCAGG - Intergenic
1203053578 16_KI270728v1_random:898079-898101 AACAAAAAATAATTGGAAGAAGG + Intergenic
1150440984 17:65191290-65191312 GACAAATAAAAATTGGAAACTGG - Intronic
1154294376 18:13136492-13136514 GACAGCTAATATTTTAAAGCTGG + Intergenic
1154972372 18:21423427-21423449 GAGAAATAATCCTTGGAAGCAGG + Intronic
1156081678 18:33343181-33343203 GACAGGTAATATATAGAAGCAGG + Intronic
1156874454 18:41991221-41991243 TACAGAAAATAATTGTATGCAGG + Intronic
1157883809 18:51346907-51346929 GAAATATATGAATTGGAAGCTGG + Intergenic
1159289998 18:66404878-66404900 GACAGTTTAGAATTGGAAACCGG + Intergenic
1160305184 18:77726950-77726972 GACAGCTCATAAATGGAAGCTGG - Intergenic
1161799452 19:6408391-6408413 GACTGAAAATATTTGGATGCCGG - Intergenic
1162088973 19:8265642-8265664 GACCCAAAAGAATTGGAAGCAGG + Intronic
1162673320 19:12277220-12277242 CAGAGAGAATATTTGGAAGCTGG + Intronic
1162686019 19:12385085-12385107 GTAAGAGAATATTTGGAAGCTGG + Intronic
1162686915 19:12394527-12394549 TACAGAGAATATTTGGAAGCTGG + Intronic
1162691262 19:12434312-12434334 TACAGAGAATATTTGGAAGCTGG + Intronic
1164848511 19:31458142-31458164 GAGAGATAATAATTGGCAGAGGG - Intergenic
1166642418 19:44505143-44505165 GAAAGAGAACACTTGGAAGCTGG + Intronic
924995895 2:360475-360497 TACTGAAAATAATTGGAAGCAGG + Intergenic
927050566 2:19324191-19324213 GTCAGATAATACTTAGAAGAAGG + Intergenic
927371410 2:22359410-22359432 TATAGAAAAAAATTGGAAGCTGG + Intergenic
927498018 2:23563687-23563709 CACAGTTATTAATGGGAAGCAGG - Intronic
929722071 2:44380123-44380145 GGCAGATAATTATTTGAAGAGGG - Intronic
929960595 2:46493342-46493364 GCCAGATAAAAGTGGGAAGCTGG + Intronic
930603709 2:53470677-53470699 GAGAGTTGATAATTGGTAGCAGG - Intergenic
931064229 2:58566623-58566645 TTCAGATACAAATTGGAAGCTGG - Intergenic
931215032 2:60234242-60234264 GACAGAGAATAACTGGAAAGAGG + Intergenic
931449203 2:62353674-62353696 AACAAATAATACTTGGCAGCAGG - Intergenic
932915584 2:75854847-75854869 GAGAGAGAATAAGTGCAAGCCGG - Intergenic
933020849 2:77189015-77189037 AACAGCTAATAAGTGGAAGATGG + Intronic
937611120 2:123862904-123862926 TACCCAAAATAATTGGAAGCAGG + Intergenic
939773880 2:146360280-146360302 GACAAACACTAATTTGAAGCTGG + Intergenic
941391180 2:164916867-164916889 CACAGCTAATAAGTGGAAGGAGG - Intronic
944315533 2:198281567-198281589 CACTGAAAATAATTGAAAGCAGG - Intronic
944992989 2:205259067-205259089 ATCATATAAAAATTGGAAGCAGG - Intronic
947751401 2:232534614-232534636 GACAGAAAATGATTGGCAGCTGG - Intronic
948688602 2:239687922-239687944 GACAGATAATTAGTGGAAGGGGG - Intergenic
1169524611 20:6410028-6410050 GAAAGATAAAAACTGGAAGATGG + Intergenic
1169561764 20:6809201-6809223 TACCGAAAATAATTGAAAGCAGG - Intergenic
1169668667 20:8069491-8069513 GAAACATAAGAATTTGAAGCAGG + Intergenic
1169990404 20:11496933-11496955 TACAGAGAATAAATGAAAGCTGG + Intergenic
1177203101 21:17979224-17979246 GACAGAAAAGAAGTGGAAGAAGG + Intronic
1177925183 21:27205271-27205293 GACAGAGAGAAATTGGAAGGAGG - Intergenic
1177999883 21:28149320-28149342 GAGTGGTAATAATTGGAGGCCGG + Intergenic
1184999416 22:48235308-48235330 GAGGGATAATGAATGGAAGCGGG - Intergenic
949143663 3:667995-668017 AACACATAGTAATTGGAAGGAGG - Intergenic
956381427 3:68668378-68668400 TCCAGATAATAATTAAAAGCAGG + Intergenic
957268242 3:77995500-77995522 GACAGTGAATAATTGTAAGAGGG - Intergenic
960025966 3:113009847-113009869 GACAGAACATCAATGGAAGCTGG + Intronic
960313321 3:116144062-116144084 GGCAGATAAAATTTGGAAGTGGG + Intronic
965222886 3:165950860-165950882 ATCAGATAATAAATGGAATCTGG - Intergenic
965949188 3:174283658-174283680 GATAGATAATAATTGGGAGGGGG - Exonic
966217999 3:177522114-177522136 GAATGCTAATAATTGAAAGCAGG - Intergenic
968646362 4:1742871-1742893 GACAGAAAATCATTTGAACCTGG + Intronic
970596110 4:17601833-17601855 AACAGAAAATATTTTGAAGCGGG - Intronic
971834905 4:31750087-31750109 GAAAGATAAGAATTGTAAGAAGG + Intergenic
972194513 4:36637279-36637301 GACAGAAAACAATAGGATGCAGG + Intergenic
976174761 4:82339960-82339982 GAATGATAATAATTGAAAGGAGG - Intergenic
977438601 4:97034152-97034174 TAAAGATGAAAATTGGAAGCAGG + Intergenic
978623045 4:110653653-110653675 GAGACAAAATAATTGGAAGGGGG + Intergenic
980370922 4:131869118-131869140 GAGAGACAATAATTGCAAGAGGG + Intergenic
981524532 4:145696734-145696756 GACAAATAAAAATTGTAGGCCGG + Intronic
982156894 4:152532523-152532545 GACAGATAAAATTACGAAGCTGG - Intronic
983094721 4:163548234-163548256 GACAGATAAAAAGTGGAAGCTGG + Intronic
983863878 4:172740052-172740074 GTCAGAGAATAAATGGGAGCTGG - Intronic
984265470 4:177493722-177493744 GACAGGTAATAATTGAACACTGG - Intergenic
984406514 4:179338570-179338592 TACAGATTATAATAGAAAGCGGG - Intergenic
987944829 5:24591926-24591948 GAAAGATAATAACTGAAATCTGG - Intronic
989487386 5:42007945-42007967 GACAGTTAATAATTTGGAGTAGG + Intergenic
989801821 5:45551686-45551708 GAAAGATAATTGTTGGAAACAGG - Intronic
990290198 5:54342239-54342261 CACAGATAACAATTTGAAGATGG + Intergenic
990881937 5:60548188-60548210 GAGAGATAGTAATTTGAAGAGGG - Intergenic
992494466 5:77279403-77279425 CACAGATGACAACTGGAAGCTGG - Intronic
998310991 5:141131374-141131396 GAAAAATAATAATTGGAAAATGG + Intronic
998398349 5:141834270-141834292 GGCTGATAATAAATGGTAGCCGG + Intergenic
999368666 5:151039387-151039409 GACACATAATAATTGAGGGCAGG - Intronic
999628970 5:153550169-153550191 GACATAGAATAATTTGGAGCTGG - Intronic
1003196464 6:3919443-3919465 TAAAAATAATAATTGGCAGCTGG - Intergenic
1004589437 6:17034720-17034742 TAAAGATAATAATTGCAAGGGGG + Intergenic
1004590243 6:17043793-17043815 TAAAGATAATAATTGGAAGGGGG - Intergenic
1004612276 6:17254366-17254388 GATAGCAAAGAATTGGAAGCCGG + Intergenic
1005598241 6:27399752-27399774 GAAGTATAATAATTGGAAGAAGG + Intronic
1008009615 6:46452124-46452146 TACAGATATTTATTGAAAGCTGG - Intronic
1009857031 6:69277665-69277687 TACAAATAATAATTGGAGGTGGG - Intronic
1010914300 6:81596618-81596640 AAAAGAGAATAATTGGTAGCTGG + Intronic
1013803966 6:113976399-113976421 GACAGATAAGACTTGCAATCTGG - Intronic
1014174098 6:118312847-118312869 GACAAAAATTAATTGGAAGTTGG - Intronic
1014933097 6:127356791-127356813 GGCAGATAAAAGTTGGAAGGCGG - Intergenic
1016228948 6:141777919-141777941 GATAGACAGAAATTGGAAGCTGG + Intergenic
1016983056 6:149870587-149870609 GACAAATAAAAATTGTAGGCTGG + Intergenic
1020554901 7:9658680-9658702 CAAGGATAATAATTGGAAGAAGG + Intergenic
1021844915 7:24755305-24755327 GACTGCTAATGATTGGAAGGGGG - Intronic
1022690800 7:32650994-32651016 GACAGTTAATAATTGGAGGTAGG - Intergenic
1022918363 7:34984823-34984845 GACAGTTAATAATTGGAGGTAGG - Intronic
1023723614 7:43119809-43119831 GACAGAGATTTATTGAAAGCTGG - Intronic
1028032551 7:85933852-85933874 GAGAGATAATAAATGCTAGCAGG - Intergenic
1029242887 7:99176885-99176907 AACAAAAAAAAATTGGAAGCAGG + Intronic
1030369471 7:108681944-108681966 TACAAATAATAGTTGGAAGAAGG + Intergenic
1031505529 7:122577095-122577117 GAGAGAGAATAAGTGCAAGCAGG - Intronic
1034578177 7:152019509-152019531 GACAGAAAAAAATTGGGATCTGG + Intronic
1035018353 7:155785860-155785882 GACACAGAAGAATTGGAAGCAGG - Intergenic
1035756788 8:2039691-2039713 GAGAGATAAGAATTGGAGTCTGG - Intergenic
1037167569 8:15849219-15849241 GCCACATAATCTTTGGAAGCAGG + Intergenic
1037367387 8:18137224-18137246 GAAAAATAATAATTGGGAACTGG - Intergenic
1038082415 8:24154004-24154026 TACACAAAATAATTGAAAGCAGG + Intergenic
1039874459 8:41573820-41573842 TACACAAAATAATTGAAAGCAGG + Intergenic
1041849751 8:62377731-62377753 GAGAGAGAATAAGTGCAAGCAGG - Intronic
1044932409 8:97262521-97262543 GACAGCTAAGACTTGGAATCAGG - Intergenic
1045039252 8:98205843-98205865 CAATGACAATAATTGGAAGCAGG + Intronic
1047151440 8:122267831-122267853 GTCAGATAATCCTTGCAAGCAGG - Intergenic
1047768989 8:128015477-128015499 GTCAGATAATAGTTTGAAGCTGG + Intergenic
1049439958 8:142604800-142604822 GACAGTGACTGATTGGAAGCAGG + Intergenic
1050858862 9:10397949-10397971 GACTGATATTAATTAGGAGCAGG + Intronic
1052482261 9:29046338-29046360 GACATATAGTAGTTTGAAGCTGG - Intergenic
1055588894 9:77788621-77788643 GAAAAATGAAAATTGGAAGCAGG + Intronic
1055641975 9:78325913-78325935 AACAGAAAAAAATTGAAAGCAGG - Intronic
1057736636 9:97668399-97668421 GACATATAATAATTCAAAGTGGG - Intronic
1058714615 9:107712669-107712691 GAAAGAGAAGAAGTGGAAGCAGG + Intergenic
1059286839 9:113180645-113180667 GAGAGATAATAATTTGACACAGG + Intronic
1059570930 9:115434742-115434764 GAGAGATAATGAGTGCAAGCAGG - Intergenic
1059614229 9:115931431-115931453 AACTGTTAATAATGGGAAGCAGG - Intergenic
1060182248 9:121542286-121542308 GACCCAAAATAATTGAAAGCAGG + Intergenic
1060352627 9:122872072-122872094 AACAAATAATAATTGGGGGCCGG - Intronic
1060699756 9:125740480-125740502 TACAGATAAAAATTAGAAGGTGG + Intergenic
1061049659 9:128186886-128186908 GTCCTAGAATAATTGGAAGCTGG - Intronic
1062077722 9:134600977-134600999 GACAGTTAACTATGGGAAGCTGG - Intergenic
1185950189 X:4423690-4423712 GACCCAAAATAATTGGAAGTGGG - Intergenic
1186325731 X:8474871-8474893 GATAGATAAATTTTGGAAGCTGG - Intergenic
1186603673 X:11066028-11066050 GAGAGAGAATAAGTGCAAGCAGG - Intergenic
1186924992 X:14323795-14323817 GGAAGATAAAAATTGGGAGCTGG - Intergenic
1187189940 X:17024726-17024748 GAGAGATCACAATTGGGAGCGGG + Intronic
1188175726 X:26986303-26986325 GACATATAATAATTGTAGGCCGG - Intergenic
1188291530 X:28394956-28394978 GGCAGATAATACTGGGAAGAAGG + Intergenic
1189769026 X:44403864-44403886 GACAAATAATGAATGGATGCTGG - Intergenic
1193794775 X:85860191-85860213 GACAGGTAATCATTAGAACCTGG - Intergenic
1194450408 X:94038689-94038711 GACAGATAATAAATGTCAGGAGG - Intergenic
1195067300 X:101249202-101249224 GACTGTAAATCATTGGAAGCAGG - Intronic
1196668045 X:118336786-118336808 AACAGAGAAAAATAGGAAGCAGG + Intergenic
1196869221 X:120096970-120096992 GACCGGTAATGAATGGAAGCTGG - Intergenic
1196912000 X:120493111-120493133 GACAGGTAGTACTTGGAAGGAGG - Intergenic
1197115761 X:122831499-122831521 CACAGAAAAAAATGGGAAGCAGG + Intergenic
1198651994 X:138873230-138873252 GCCAGAAAAAAATTGGAAGGAGG + Intronic
1199414943 X:147571035-147571057 GACAGATAAAAATTCAAAGCAGG + Intergenic