ID: 1131026266

View in Genome Browser
Species Human (GRCh38)
Location 15:89144421-89144443
Sequence ACTGAATGGTAGGCCCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131026266_1131026270 11 Left 1131026266 15:89144421-89144443 CCACACCGGGCCTACCATTCAGT 0: 1
1: 0
2: 1
3: 22
4: 216
Right 1131026270 15:89144455-89144477 ATGAAAAAATAAACAAAATGTGG 0: 1
1: 32
2: 475
3: 2569
4: 9738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131026266 Original CRISPR ACTGAATGGTAGGCCCGGTG TGG (reversed) Intronic
903744351 1:25576766-25576788 ACTGAAGGGCAGGCCGGATGGGG - Intergenic
903949771 1:26989559-26989581 ACACAAGGGTAGGCCGGGTGCGG - Intergenic
904561700 1:31402559-31402581 AATGAATTTTAGGCCAGGTGCGG - Intergenic
905163330 1:36057028-36057050 AAAGAATAGTAGGCCGGGTGCGG - Exonic
905703280 1:40035569-40035591 ACTCAAAGTTAGGCCAGGTGTGG - Intergenic
906017412 1:42594216-42594238 ACTTAATTATAGGCCAGGTGTGG + Intronic
911469230 1:98296110-98296132 ACTTAATCCTAGGCCAGGTGCGG + Intergenic
911989207 1:104670964-104670986 ATTTTATGGTAGGCCAGGTGTGG + Intergenic
913454939 1:119020972-119020994 ACTGACTGGTGGGCCACGTGTGG - Intergenic
915015279 1:152727365-152727387 ACTACAGGGTAGGCCAGGTGAGG + Intergenic
918698878 1:187581906-187581928 ACTGAATCTCAGGCCCGGCGTGG + Intergenic
919622193 1:199875602-199875624 ACTGAATGGGAGGCCAGGTGTGG + Intergenic
920242634 1:204564427-204564449 ACAGAGTGATAGGCCGGGTGCGG + Intergenic
920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG + Intronic
921660357 1:217793823-217793845 ACTGAAAAGGAGGCCGGGTGCGG + Intronic
921852264 1:219943807-219943829 ACTCAATGGGAGGCCAGGCGCGG + Intronic
922625465 1:227036718-227036740 ACTGAATTGAAGGCCGGGCGCGG - Intronic
924091915 1:240510077-240510099 AGCAAATGGTAGGCCGGGTGCGG + Intronic
924574447 1:245266953-245266975 ACTGAAGGGCAGGCCCCCTGTGG + Intronic
924616278 1:245614461-245614483 ACTGAAGGAGAGGCCAGGTGCGG - Intronic
1064819463 10:19309756-19309778 ACAGAATGGTAGGCTCCATGGGG + Intronic
1065366559 10:24942936-24942958 ATTGTATGATAGGCCAGGTGTGG - Intronic
1071858431 10:89648601-89648623 ACTGAATTGTAAGCCCTTTGAGG - Intergenic
1072151013 10:92683814-92683836 AATGGATGGTAGGCCGGGCGCGG + Intergenic
1072907110 10:99464603-99464625 AATAAATGGTAGGCCCGGCTGGG - Intergenic
1073377591 10:103050239-103050261 AGTGAATGGGAGGCCGGGCGTGG + Intronic
1075397485 10:122138217-122138239 ACTGAATGATAGGTTGGGTGCGG + Intronic
1078110420 11:8387795-8387817 ACTGAAGGGTGGGGCGGGTGGGG - Intergenic
1078361213 11:10669312-10669334 ACTGAAAGCTAGGCCCAGAGAGG - Intronic
1081328976 11:41780784-41780806 ACTGAATGAGTGGCCAGGTGCGG - Intergenic
1081503816 11:43694408-43694430 AGTGAAAGGTTGGCCAGGTGTGG + Intronic
1081864197 11:46350743-46350765 TCTGAATGGCAGCCCCTGTGGGG + Intronic
1081923283 11:46799706-46799728 AATGAATTTTAGGCCGGGTGTGG + Intronic
1082214466 11:49551441-49551463 ATTGTATGGTAGGCAGGGTGTGG + Intergenic
1084037669 11:66522634-66522656 AATGCATGTTAGGCCGGGTGTGG - Intronic
1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG + Intronic
1087274655 11:96149121-96149143 ATTGAAAAGTAGGCCAGGTGTGG + Intronic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088243447 11:107793727-107793749 ACTGAGTGTAAGGTCCGGTGAGG + Intronic
1088501723 11:110490082-110490104 ACTGCATGGTAGACCCCATGGGG + Intergenic
1092149958 12:6241084-6241106 AATGAATGGTTGGCCAGGCGTGG - Intergenic
1097117594 12:56709329-56709351 ACTGAGAGGAAGGCCCGTTGCGG + Intergenic
1098012689 12:66071386-66071408 ACTGCATGGTACGCCCTGGGGGG + Intergenic
1098295693 12:69001814-69001836 AATGTAAGGTAGGCCGGGTGTGG + Intergenic
1101594364 12:106150896-106150918 AGTGAATGAGAGGCCAGGTGGGG + Intergenic
1101966200 12:109283764-109283786 AATAAATGTTAGGCCGGGTGCGG - Intronic
1101977670 12:109375441-109375463 ATTGAATGGCTGGCCGGGTGTGG - Intronic
1102343221 12:112140128-112140150 ACTGAATTGGAGGCCGGGCGTGG + Intronic
1103345090 12:120244074-120244096 ACTGTATGCAAAGCCCGGTGAGG + Intronic
1105457262 13:20552877-20552899 ATTAAATGGAAGGCCAGGTGTGG - Intergenic
1108097485 13:46918875-46918897 ACAGCATGGTAGGCCAGGCGCGG - Intergenic
1110592593 13:77282118-77282140 TCTGAATGTGAGGCCGGGTGTGG + Intronic
1111874689 13:93878666-93878688 TCTGAAGGGTAGGCCAGGAGCGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114264940 14:21068473-21068495 AAGGAATGGAAGGCCTGGTGAGG + Intronic
1114520221 14:23329354-23329376 ACTAAATGGCAGGCCCTGTGAGG - Intergenic
1119524190 14:75309257-75309279 ACTGCATCATAGGCCGGGTGCGG - Intergenic
1120931683 14:89855185-89855207 AATAAATGTTAGGCCAGGTGTGG + Intronic
1122725732 14:103750538-103750560 ACTGGATTGCAGGCCGGGTGCGG + Intronic
1123438716 15:20274298-20274320 ACTGCACAGTAGGCCAGGTGTGG + Intergenic
1124963562 15:34416507-34416529 ACTGACTGGGAGGCTGGGTGTGG + Intronic
1124980181 15:34562733-34562755 ACTGACTGGGAGGCTGGGTGTGG + Intronic
1125027212 15:35042709-35042731 ACTGAAGGATAGGCCGGGCGTGG + Intergenic
1126601123 15:50428405-50428427 ACTAAATTGTAGGCCCGGCGTGG - Intronic
1127813138 15:62581751-62581773 AGTGAATAGTGGGCCGGGTGCGG + Intronic
1128163217 15:65438459-65438481 ATTAAATGCTAGGCCGGGTGAGG + Intergenic
1128279520 15:66383555-66383577 AGTGAATTGAAGGCCAGGTGTGG - Intronic
1128743888 15:70100517-70100539 ACTGAGAGGGAGGCCCGGCGAGG - Intergenic
1129477233 15:75793883-75793905 ACTGCATGCAAGGCCGGGTGTGG - Intergenic
1129485019 15:75862524-75862546 ACTGATTGGGAGGCTGGGTGTGG + Intronic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1131251234 15:90831628-90831650 ATGGAATGGAAGGCCGGGTGTGG + Intergenic
1131813024 15:96192657-96192679 ACTGAATAATAGGCCGGGCGCGG - Intergenic
1132488536 16:211070-211092 ACTAAATGGTAGGCCCAGCACGG + Intronic
1132812343 16:1807224-1807246 TCTGAATGGTAGGGGTGGTGGGG - Intronic
1132818054 16:1844412-1844434 ACAGAATGCTTGGCCAGGTGTGG - Intronic
1133210962 16:4263316-4263338 TCTGACTAGCAGGCCCGGTGGGG + Intronic
1136131237 16:28223085-28223107 ACTGAAAGGTGGGCCAGGCGTGG - Intergenic
1136252983 16:29018823-29018845 AATAAATCGTAGGCCAGGTGAGG - Intergenic
1138126892 16:54446593-54446615 ACTGACTGGTGGGCCCAGTGGGG - Intergenic
1138402197 16:56755583-56755605 ACTGAATTGTAGGCCAGGCATGG + Intronic
1140293091 16:73682493-73682515 AAAGAAAGGTAGGCCGGGTGCGG + Intergenic
1140396648 16:74632955-74632977 AATGAATCATAGGCCAGGTGTGG - Intronic
1141403892 16:83774662-83774684 AATAAATGGTAGGCCGGGTGTGG - Intronic
1142390366 16:89795891-89795913 GCTGAAAGGTAGGCCCAGTGTGG - Exonic
1142787351 17:2234551-2234573 AAATAATGGTAGGCCGGGTGCGG - Intronic
1144066625 17:11630142-11630164 ACTGTATTGCAGGCCAGGTGCGG + Intronic
1144567381 17:16371136-16371158 AATGAATTGTAGGCTGGGTGTGG - Intergenic
1144644395 17:16962214-16962236 AAAGAAAGGTAGGCCAGGTGTGG + Intronic
1145098910 17:20057149-20057171 ACAGAAAGGTTGGCCGGGTGCGG + Intronic
1146223079 17:31043089-31043111 ACTGAATATTTGGCCAGGTGAGG - Intergenic
1146341918 17:32026898-32026920 ACTGAATATTTGGCCAGGTGAGG + Intronic
1146350891 17:32092741-32092763 ACTGAATATTTGGCCAGGTGAGG - Intergenic
1148058810 17:44820011-44820033 ACTGAATGATTAGCCAGGTGTGG - Intronic
1148288573 17:46419564-46419586 ACTGAATGGCAGGCCGGGCGCGG - Intergenic
1148310742 17:46637142-46637164 ACTGAATGGCAGGCCGGGCGCGG - Intronic
1148362519 17:47024064-47024086 ACTGAATATTTGGCCAGGTGAGG + Intronic
1149445734 17:56711939-56711961 AAAGAATGGTAGACCCAGTGCGG - Intergenic
1149968611 17:61193465-61193487 ACTGAATTTTTGGCCAGGTGCGG + Intronic
1149992806 17:61392186-61392208 ACTGAAGGGTAGGACCAGAGCGG - Exonic
1151523170 17:74645697-74645719 AGTGCAAGGTAGGCCGGGTGCGG + Intergenic
1151540741 17:74763513-74763535 CCTGAATGGTAAGCCAGGTGGGG + Exonic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1153579772 18:6561245-6561267 ACTGATGAGTAGGCCGGGTGTGG + Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1156088901 18:33441291-33441313 ACTAAGTGGCAGGCCGGGTGTGG + Intergenic
1157196978 18:45627410-45627432 ACTAGATGGTAGGCTCTGTGAGG - Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1161097337 19:2400249-2400271 ATTGTATGGAAGGCCGGGTGTGG + Intronic
1162056043 19:8064741-8064763 AATAAATGTTAGGCCAGGTGTGG + Intronic
1162599363 19:11655964-11655986 ACTATATGGCAGGCCGGGTGCGG + Intergenic
1163212460 19:15851284-15851306 TCTGATTGGCAGGCCAGGTGCGG - Intergenic
1163581468 19:18141844-18141866 AAAGAATGGTAAGCCGGGTGCGG - Intronic
1164760265 19:30723194-30723216 AATGAATGGAAGGCAGGGTGTGG - Intergenic
1165059928 19:33200151-33200173 ACAGAAGGGAAGGCCCAGTGAGG - Intronic
1166939114 19:46352213-46352235 ACTGGATGGTAAGCCCTGGGAGG + Intronic
925066103 2:929858-929880 ACTGATTTGTAAGCCAGGTGAGG - Intergenic
925351340 2:3203051-3203073 ACTCAATGCCAGGCCCTGTGCGG + Intronic
926057375 2:9781986-9782008 ACTGAGTTGTTGGCCGGGTGAGG - Intergenic
927196458 2:20551052-20551074 ACTTAGTGCTAGGCCCTGTGTGG + Intergenic
930623681 2:53671467-53671489 ACTGTATGATAGGCCAGGCGCGG + Intronic
930702926 2:54477621-54477643 ACTGACTGGTAGGCTGGGCGCGG + Intronic
931148742 2:59548634-59548656 ACAGAATGAAAGGACCGGTGAGG + Intergenic
931401625 2:61936721-61936743 ACTGTATGGAAGGCCAGGTGTGG - Intronic
931465582 2:62483889-62483911 TCTGTATCGTAGGCCGGGTGTGG - Intergenic
931690517 2:64831471-64831493 ACTCAGTGGGAGGCCCAGTGGGG - Intergenic
931999920 2:67875808-67875830 ACTGCAGGATAGGCCAGGTGTGG + Intergenic
932131098 2:69187877-69187899 AATACATGGTAGGCCAGGTGCGG - Intronic
932625692 2:73293829-73293851 ACCGGACGGTCGGCCCGGTGAGG - Intergenic
938249429 2:129802698-129802720 ACTGAATGCTTGGCAGGGTGGGG - Intergenic
938744506 2:134264310-134264332 ACTTAATGGCTGGCCGGGTGCGG - Intronic
942876424 2:180805076-180805098 ACTGAATCCTAGGGCCTGTGTGG - Intergenic
946223875 2:218251741-218251763 ACTGAGTGCTGGGCCAGGTGTGG - Intronic
946363966 2:219237054-219237076 ACTGAAAGGTAGGCCGGGCATGG - Exonic
947082414 2:226413168-226413190 ACTGAATGATAGGCCTCTTGGGG + Intergenic
948812748 2:240492976-240492998 ACTGATTTTTAGGCCAGGTGAGG - Intronic
1170595798 20:17804774-17804796 ACTGAAAGATAGGCCGGGCGCGG + Intergenic
1171174022 20:23037810-23037832 TCTGAATGCTAAGCCAGGTGGGG - Intergenic
1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG + Intergenic
1172353345 20:34261002-34261024 ACTGTGTGGTAGGCACTGTGAGG + Intronic
1173592967 20:44239856-44239878 ACTGCATGGCAGGCCAGGTGTGG + Intergenic
1177494735 21:21873808-21873830 ACCAAATAGTAGGCCTGGTGCGG + Intergenic
1177503349 21:21987983-21988005 ACTGATGGATAGGCCGGGTGCGG + Intergenic
1179526190 21:41977453-41977475 ACTGGATGGTTGGCACTGTGGGG + Intergenic
1179885050 21:44310314-44310336 ACTGGATGGAAGGCCCAGTGTGG + Intronic
1181148277 22:20864377-20864399 TCTGAATGGAATGCCCAGTGTGG - Intronic
1182430791 22:30297757-30297779 ATTGAATGGAGGGCCCTGTGGGG + Intronic
1182514099 22:30843072-30843094 ACTGAATTGCAGGCCGGGTGCGG - Intronic
1182630681 22:31682924-31682946 ACTGAATGTTAAGACAGGTGTGG + Exonic
1183506102 22:38209856-38209878 ATTGAAAGGTAGGATCGGTGAGG + Intronic
1183811056 22:40257730-40257752 AATGAATGGACGGCCAGGTGCGG + Intronic
1183980007 22:41533811-41533833 ACTGAATGTTGGGCCATGTGGGG - Intronic
1184100483 22:42339500-42339522 ACTGCATGGAAGGCCAAGTGAGG + Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184181714 22:42832693-42832715 GCTAAATAGTAGGCCCGGTGTGG + Intronic
1185260964 22:49862990-49863012 ACTGAAAGGCTGGCCGGGTGCGG - Intronic
949183271 3:1160107-1160129 ACTGAATGATTGGCCGGGCGTGG - Intronic
951559650 3:23953046-23953068 AATGATTGATAGGCCCGGTGCGG + Intronic
958597393 3:96245091-96245113 AAAGAATGCTAGGCCAGGTGCGG - Intergenic
958657852 3:97025876-97025898 ACTTAAATGTAGGCCAGGTGTGG - Intronic
959315973 3:104807163-104807185 TCTGAATGCTAGGCCCTGTGTGG + Intergenic
959568033 3:107852719-107852741 ACTAAATGGTAGGACAGGTGAGG + Intergenic
960107675 3:113815678-113815700 ACAGGAGGGTAGGCCGGGTGCGG + Intergenic
960444358 3:117729600-117729622 ACTGAATGGCAGGGTGGGTGGGG - Intergenic
963135592 3:141900664-141900686 ATTGAATTGTACGCCCAGTGTGG + Intronic
963722658 3:148880620-148880642 AGTGAATTGTAGGCCCAGTGTGG - Intronic
965920351 3:173905800-173905822 ACTGAATGGTAGGATTTGTGGGG + Intronic
966408406 3:179623380-179623402 ACTGTTTGGTAGGCCGGGTGCGG + Intronic
967889511 3:194355083-194355105 AGTGAGTGGGAGGCCGGGTGCGG - Intergenic
971926462 4:33015344-33015366 ACAGAATGTTAGGCCAGGCGTGG - Intergenic
972426720 4:38940179-38940201 AATGAAAGGCAGGCCAGGTGTGG - Intronic
972532205 4:39971444-39971466 CCTTAAAGGCAGGCCCGGTGCGG - Intronic
974802657 4:66838477-66838499 AAGGATTGGTAGGCCCTGTGGGG + Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
983530421 4:168804646-168804668 ACTTAATAGTAGGTCAGGTGTGG - Intronic
984374635 4:178911965-178911987 AAGGAAAGGTAGGCCAGGTGCGG + Intergenic
984473409 4:180205811-180205833 ACTGAATGGCAGGCCACATGTGG + Intergenic
986350592 5:6875605-6875627 ACAGAATGGAAGGGCAGGTGCGG - Intergenic
988556428 5:32240108-32240130 AATGAATTGTAGGCCGGGCGCGG + Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
990417659 5:55601530-55601552 ACTGGTTGGCAGGCCCGGGGAGG + Intergenic
991992800 5:72358087-72358109 AATGTATGGTAGGCCAGGCGAGG - Intronic
995320099 5:110824398-110824420 ACTGGATTGGAGGCCAGGTGGGG - Intergenic
997987384 5:138513492-138513514 ACAGTATGGTGGGCCGGGTGCGG - Intronic
999734782 5:154505003-154505025 TCTTAATTGTAGGCCGGGTGCGG - Intergenic
1000113262 5:158129434-158129456 ACTAAAAGATAGGCCGGGTGCGG + Intergenic
1002716555 5:181231637-181231659 ACTGAATGGTAGGATCTGTCTGG + Intronic
1003353544 6:5343500-5343522 ACTGAAATGTAGGCCAGGCGCGG - Intronic
1005013331 6:21356421-21356443 ACTGAATATTGGGCCGGGTGTGG - Intergenic
1005752293 6:28894713-28894735 ACCCTATGGTAGGCCCGGAGTGG - Intergenic
1006330584 6:33387765-33387787 ATGGAATGGTAGGCCAGGTGCGG + Intergenic
1006673423 6:35744508-35744530 ACTGAATGTTAGGCCAGGCATGG + Intronic
1010003456 6:70971107-70971129 ACTGAAGTGTAGGCCAGGCGTGG - Intergenic
1012752372 6:103180150-103180172 AATGAATGGTAGGCCAGATTTGG - Intergenic
1014037339 6:116782102-116782124 AGTGAATGATTGGCCGGGTGTGG - Intergenic
1016064375 6:139663888-139663910 ACTGAATTGTTGGTCGGGTGCGG - Intergenic
1016974314 6:149792022-149792044 AAGGAATGATAGGCCGGGTGTGG + Intronic
1019260574 7:79706-79728 CCTAGATGGTAAGCCCGGTGAGG - Intergenic
1019605603 7:1908648-1908670 ACTGAAAGAGAGGCCGGGTGCGG - Intronic
1020246280 7:6432058-6432080 AATGAAAAATAGGCCCGGTGTGG + Intronic
1021205009 7:17769487-17769509 ACAGAATGCGAGGCCAGGTGCGG - Intergenic
1024685991 7:51745703-51745725 ACTGAAATGTATTCCCGGTGTGG + Intergenic
1025696210 7:63776339-63776361 AGAAAATGGTAGGCCAGGTGTGG - Intergenic
1025944688 7:66096729-66096751 AATTCATGGTAGGCCAGGTGTGG - Intronic
1026049231 7:66931010-66931032 GATGAATGGTGGGCCTGGTGTGG + Intronic
1028545281 7:91992371-91992393 ACTCAATTGTAGGCCAGGCGTGG + Intronic
1029694389 7:102203389-102203411 ACTGAGTGGAAGGCGGGGTGGGG - Intronic
1032010868 7:128347007-128347029 AATGCCTTGTAGGCCCGGTGTGG + Intergenic
1032392809 7:131567072-131567094 AGTGAATGTGAGGCCAGGTGCGG - Intergenic
1035982956 8:4393264-4393286 ACTGCTTTGTAGGCCAGGTGGGG - Intronic
1036461446 8:8956896-8956918 AATGAATGATTGGCCAGGTGTGG + Intergenic
1037088160 8:14879032-14879054 ACCTAATTGTAGGCCAGGTGTGG + Intronic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1039098565 8:33914553-33914575 GCTGAGTGGTAAGCCTGGTGTGG - Intergenic
1045539154 8:103065751-103065773 ATTGAATGGTAAGCCAGGCGTGG + Intronic
1048566873 8:135609583-135609605 TCAAAAAGGTAGGCCCGGTGTGG - Intronic
1049319414 8:141988037-141988059 TCTGAAGGGAAGGCCAGGTGCGG - Intergenic
1051515990 9:17930904-17930926 GCTGAATGGAAGCCCAGGTGGGG + Intergenic
1052967780 9:34353962-34353984 AGTGAAGTGTAGGCCCGGCGCGG + Intergenic
1053118864 9:35530239-35530261 ACTGAATGGCTGGCCAGGTAGGG - Intronic
1058305943 9:103440739-103440761 ATTGAATAATAGGCCAGGTGCGG + Intergenic
1058860750 9:109115818-109115840 AGTGGATTGTAGGCCAGGTGCGG - Intronic
1059130843 9:111747873-111747895 ACTGAATAATAGGCCTAGTGCGG - Intronic
1059743237 9:117174953-117174975 ACTGAATGGGAGGCCCAGTCTGG + Intronic
1059979175 9:119750921-119750943 ACTGGATGCTGGGCCGGGTGCGG + Intergenic
1061205221 9:129159144-129159166 AGTGGATGGTAAGCCCAGTGAGG + Intergenic
1062258217 9:135641347-135641369 ATTAAAGGGTAGGCCGGGTGCGG + Intergenic
1062744112 9:138200684-138200706 CCTAGATGGTAAGCCCGGTGAGG + Intergenic
1187890985 X:23934812-23934834 ACTGATTAGTTGGCCAGGTGCGG - Intronic
1188472178 X:30553382-30553404 AATAAATAGTAGGCCGGGTGCGG + Intergenic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1190028869 X:46952705-46952727 AATCAATGGGAGGCCAGGTGCGG + Intronic
1190176106 X:48151293-48151315 ATTCAATGGTAGGCCGGGCGTGG + Intergenic
1190202694 X:48377440-48377462 ACTCAACCGTAGGCCGGGTGTGG + Intergenic
1190207844 X:48417970-48417992 ACTCAACCGTAGGCCGGGTGTGG - Intergenic
1192178257 X:68899232-68899254 ACAGACTGGTAGGCCTGGTATGG + Intergenic
1195205796 X:102599259-102599281 AAAGAATGGTAGGCTTGGTGGGG + Intronic
1195813067 X:108855334-108855356 ACTGTCTGGTCGGCCGGGTGCGG - Intergenic
1196292176 X:113955685-113955707 AATGATTTGTAGGCCGGGTGTGG + Intergenic