ID: 1131027668

View in Genome Browser
Species Human (GRCh38)
Location 15:89158449-89158471
Sequence CTTCTCTGCTCTTCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 415}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131027668_1131027670 -6 Left 1131027668 15:89158449-89158471 CCAGCAGCTGAAGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 37
4: 415
Right 1131027670 15:89158466-89158488 GAGAAGAATAGGTTAAGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 208
1131027668_1131027673 18 Left 1131027668 15:89158449-89158471 CCAGCAGCTGAAGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 37
4: 415
Right 1131027673 15:89158490-89158512 CTTGCTCCCAGAGAGTACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 158
1131027668_1131027677 30 Left 1131027668 15:89158449-89158471 CCAGCAGCTGAAGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 37
4: 415
Right 1131027677 15:89158502-89158524 GAGTACCTGGGTCAGGAGACAGG 0: 1
1: 0
2: 1
3: 27
4: 262
1131027668_1131027672 17 Left 1131027668 15:89158449-89158471 CCAGCAGCTGAAGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 37
4: 415
Right 1131027672 15:89158489-89158511 CCTTGCTCCCAGAGAGTACCTGG 0: 1
1: 0
2: 0
3: 10
4: 167
1131027668_1131027674 23 Left 1131027668 15:89158449-89158471 CCAGCAGCTGAAGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 37
4: 415
Right 1131027674 15:89158495-89158517 TCCCAGAGAGTACCTGGGTCAGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131027668 Original CRISPR CTTCTCTGCTCTTCAGCTGC TGG (reversed) Intronic
900087788 1:906714-906736 CTCCTGTGCACTTCAGGTGCGGG - Intergenic
900138787 1:1130359-1130381 CTTCTCAGCACTCCAGCTTCAGG + Intergenic
900774515 1:4572165-4572187 CTCCCCTGCTCTACACCTGCCGG - Intergenic
900969818 1:5985382-5985404 CATCTGTGCCCTTCAGCTGGCGG - Intronic
901514158 1:9734005-9734027 CTTCAATGCCCTTCTGCTGCAGG + Exonic
902264893 1:15256313-15256335 TTTCTCTGCTCTGCAGGTTCAGG + Intronic
902310067 1:15575328-15575350 CTTCTGGGCTTTTCACCTGCAGG - Intronic
903113410 1:21157881-21157903 CTTAACTGCTATTCAGCTGCAGG - Intronic
904262582 1:29298348-29298370 CTTCTCTGCCCTCCACTTGCTGG + Intronic
906251703 1:44315451-44315473 CTGCTCTGGTGTTCTGCTGCAGG + Intronic
907191931 1:52656890-52656912 CCTCATTGCTCTCCAGCTGCGGG - Exonic
908381695 1:63603000-63603022 CCTCTCTGCTCTTCACCTTCAGG - Intronic
908740995 1:67327490-67327512 CTTCTCTTTTCTGCAGCTGTAGG + Intronic
908827556 1:68148271-68148293 ATTCTTAGCTTTTCAGCTGCAGG + Intronic
910124782 1:83828628-83828650 ACTCTCTGTTCTTCAGCTGGAGG - Intergenic
912559377 1:110539035-110539057 CTTCTCAGCTCTGTCGCTGCAGG + Intergenic
912691208 1:111805783-111805805 CTGCCCTGCTCTGCAGCCGCGGG - Intronic
916273890 1:162972670-162972692 CGTCTCTGCTCCTCAGCTGCAGG - Intergenic
917125695 1:171685539-171685561 TCTCTCTGCTCTTCAGCTTCAGG + Intergenic
918940005 1:190981582-190981604 CTTCTTTGCTCCTCAGCTTGTGG - Intergenic
919728982 1:200900969-200900991 CCTCTGTGATCTGCAGCTGCAGG - Exonic
920254178 1:204643164-204643186 CTTCTCTGTTCGTAAGCTCCTGG - Intronic
922751787 1:228073500-228073522 CTCCTCTGCCCATCACCTGCAGG - Intergenic
922938642 1:229440912-229440934 CTTCTGACCTTTTCAGCTGCTGG + Intergenic
923092153 1:230748844-230748866 CTTCTGGGCTCTTCAGGGGCAGG + Intronic
923408888 1:233688456-233688478 CTTCTCTGCTTTTCTGGGGCAGG - Intergenic
924157647 1:241196315-241196337 TTTCTCTGTTCATCTGCTGCTGG - Intronic
1063387420 10:5624819-5624841 CTTCTCTGCTTTACAGATGTGGG - Intergenic
1064136907 10:12758825-12758847 CTCCTCTCCTCTGCAACTGCTGG - Intronic
1064697331 10:17981317-17981339 CTTCTCTGCTAGGCAGCTGGTGG + Exonic
1064709520 10:18109342-18109364 CTTGTCTGCTCCTCTGCTTCTGG - Intergenic
1065166211 10:22980879-22980901 CTCCTCTGCTCTTCTCCTGAAGG + Intronic
1065304375 10:24354759-24354781 CTCCTCTGCTCTTCTGCTCATGG + Intronic
1065807602 10:29409551-29409573 CCTCTCAGCTATTCAGCAGCGGG - Intergenic
1065828043 10:29589555-29589577 CCCCTTTCCTCTTCAGCTGCCGG + Intronic
1065949716 10:30641052-30641074 CCCCTTTCCTCTTCAGCTGCCGG - Intergenic
1066287534 10:33982656-33982678 CTTGTCTGCTCATCAGCTTCTGG + Intergenic
1067490983 10:46701720-46701742 CTTCCTTGCCCTTCAGATGCTGG - Intergenic
1067603680 10:47638646-47638668 CTTCCTTGCCCTTCAGATGCTGG + Intergenic
1067659945 10:48227345-48227367 CTTCTCTGGTCTCCACCAGCTGG + Intronic
1067663845 10:48256637-48256659 CTTCTCAGCTCTGGAGCTGAAGG + Intronic
1068071216 10:52198712-52198734 GTTCTCTCCTCTTCAGATTCTGG + Intronic
1068382657 10:56277305-56277327 CTGCCCTTCTCTTCAGCTGAAGG + Intergenic
1068393820 10:56435160-56435182 CTTCCTTGCCCTTCAGATGCTGG + Intergenic
1068918754 10:62461462-62461484 CATCCCTGCTCTTCAGATGGGGG + Intronic
1071183157 10:83010257-83010279 CTTCCTTGCTCTTCAGCAGATGG - Intergenic
1072190276 10:93072501-93072523 TCTCTCTGCTCTCCACCTGCCGG - Intergenic
1073675279 10:105639582-105639604 CTACTCTGCTTTTCTGCTGTTGG - Intergenic
1074520204 10:114213773-114213795 CATTTCTGATCATCAGCTGCTGG - Intronic
1074541783 10:114371170-114371192 CATCTCTCCTCATCAGCTGCTGG + Intronic
1074614562 10:115054190-115054212 TTTCTCTCCTTTTCAGCTGCTGG + Intergenic
1076033021 10:127175527-127175549 CTCCTCCGCTCGTCATCTGCCGG + Exonic
1076867120 10:133173079-133173101 AATCTCTGGCCTTCAGCTGCAGG + Intronic
1077068651 11:657054-657076 CGTCCCTGCTCTGCAGCTGAGGG + Intronic
1077488244 11:2848813-2848835 CTTCTCTGCGGCTCAGCAGCTGG - Exonic
1078347558 11:10564291-10564313 CTTCTGTGAAATTCAGCTGCTGG + Exonic
1079665549 11:23100475-23100497 CTTCTCTGCAATTCTTCTGCAGG - Intergenic
1079672760 11:23188629-23188651 CTTCTCTGCTTTTCTGGGGCAGG - Intergenic
1079672776 11:23188692-23188714 CTTCTCTGCTTTTCTGGGGCAGG - Intergenic
1079871292 11:25801439-25801461 CTTCCCTGCTCCTCAGCTTGCGG - Intergenic
1080502634 11:32885292-32885314 CTTGTCTGCTCATCTGCTTCTGG - Intergenic
1081312612 11:41592322-41592344 CTTCTCTGCTCATCTGCCTCTGG + Intergenic
1082097023 11:48139286-48139308 CTGCTCTGAGCCTCAGCTGCAGG - Intronic
1082945839 11:58758193-58758215 CTTCTCTGGTCTTCCAGTGCTGG - Intergenic
1083323463 11:61861717-61861739 CTCCTTTCCTGTTCAGCTGCTGG + Intronic
1084118049 11:67053288-67053310 CTTCTCTGCTTACTAGCTGCGGG + Intergenic
1084276542 11:68054203-68054225 CCTCGCTGCTCTACAGGTGCAGG + Intronic
1084529453 11:69718347-69718369 CCACACAGCTCTTCAGCTGCAGG + Intergenic
1085535580 11:77215332-77215354 CTTCTTTGGTCTTAACCTGCTGG + Intergenic
1087141722 11:94770551-94770573 CTTCTCTCCTATCCACCTGCAGG - Intronic
1087437874 11:98145477-98145499 CTTCTCTTCTGTGCACCTGCAGG + Intergenic
1087908628 11:103727281-103727303 CTTCTGTGCACTGCACCTGCAGG + Intergenic
1089010409 11:115127539-115127561 CTGCTCTGTGCTTCAGCTGGGGG + Intergenic
1089031064 11:115329969-115329991 CTCCTCTGCTCTTCTGCTTGTGG + Intronic
1090085860 11:123650556-123650578 CTTCTCTGCCCTTCTTCTCCAGG - Intronic
1090093510 11:123721763-123721785 CTTCTCTGCTCTTCTGTTTGTGG - Intergenic
1090218854 11:124997496-124997518 CTACTCTGGTCTTGAGCTCCCGG + Intronic
1090237053 11:125156645-125156667 ATTCTCTTTTCTTCAGCTCCTGG - Intergenic
1092027019 12:5249483-5249505 CATCTTTGCTCTTCAGTAGCAGG + Intergenic
1092135759 12:6145895-6145917 CATCTCCACTCCTCAGCTGCAGG + Intergenic
1094368315 12:29707439-29707461 CGCCTCTGCTCTTCAGCTCCAGG + Intronic
1094549155 12:31434363-31434385 CTTCTCTGCTACTAAACTGCTGG + Intronic
1094825548 12:34266560-34266582 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1095497383 12:42799247-42799269 CTGCTCTGCTGCTCTGCTGCTGG + Intergenic
1095727601 12:45470235-45470257 CTTCTCTGCTTGTCAACTTCTGG - Intergenic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096590528 12:52655981-52656003 CCTCTCTCCTCTTCTGCTTCTGG - Intergenic
1096633511 12:52944631-52944653 CTTCTCTGAGCTTCAGCGCCTGG + Intronic
1098399087 12:70054249-70054271 CTTCTCTTCCCTTCAGGAGCAGG - Intergenic
1098575389 12:72036089-72036111 TTTCTCTGCTTTTCACCTGATGG - Intronic
1098731426 12:74040372-74040394 CTTCCCTGCTCCTCAGCTTGTGG + Intergenic
1099835866 12:87909381-87909403 CAGCTCTGCACTTCAGCTGTGGG + Intergenic
1101091102 12:101286682-101286704 CATCTCTCCTCTCCAGCTACTGG + Intronic
1101376458 12:104175564-104175586 CCTCTCAGATCTCCAGCTGCTGG - Intergenic
1102592805 12:113969707-113969729 CTACTCTGCCCTTCAGCCCCAGG - Intergenic
1103708460 12:122894162-122894184 TTTCTCTGCTTTTCAGTTGCTGG - Intronic
1103936221 12:124478434-124478456 CTTCTCTGCTCTTCAGCCTCCGG - Intronic
1104918553 12:132278799-132278821 CTCCTGTGGTCCTCAGCTGCAGG - Intronic
1105284557 13:18993695-18993717 CTTCTCTGGTCTTCTGCCTCTGG - Intergenic
1106282291 13:28286293-28286315 CTCCTCAGCTCTTCATCTTCTGG + Intronic
1106947167 13:34841655-34841677 CTGCTCAGATCTTCTGCTGCAGG - Intergenic
1107305812 13:39017918-39017940 CCTCTCTGCACTACAGCTGCAGG - Intronic
1107969436 13:45627160-45627182 TTTCTCTCCTCTTCAGCCACTGG + Intergenic
1108415161 13:50190646-50190668 CCTATCTGCTCTTCAGATGCTGG - Intronic
1108682787 13:52793768-52793790 CTGCTCTGCTCTGCAGCATCTGG + Intergenic
1111321114 13:86630362-86630384 TTTCTCTGAACTTCAGCTACCGG + Intergenic
1111630261 13:90840509-90840531 CTTCTCTGATCTTCTGGGGCAGG + Intergenic
1112030536 13:95452545-95452567 CTTTCCAGCTCCTCAGCTGCTGG + Intronic
1112325909 13:98442702-98442724 CTTCCCTGCTCCTCCGCTTCGGG - Intronic
1113061985 13:106331842-106331864 CTCCTCTGCTCATCTGCTTCTGG + Intergenic
1113553341 13:111210706-111210728 CTTCTCTGAGCTGCAGCTGGCGG + Intronic
1113909580 13:113835863-113835885 CTTCCCAGCTCTCCACCTGCTGG - Intronic
1114549238 14:23523698-23523720 CTTTCATGATCTTCAGCTGCAGG + Exonic
1114558025 14:23572833-23572855 CTTCCCTGCTCCTTAGGTGCAGG + Intronic
1115313050 14:31998317-31998339 CTTGTCTGCTGTTCTGCTACTGG + Intergenic
1116573267 14:46544989-46545011 CTTCTCTGCTCTTCTGGGGCAGG + Intergenic
1116635490 14:47389669-47389691 CTTCTCACTTCTGCAGCTGCAGG - Intronic
1116952699 14:50894128-50894150 CTTCTCTGCTCTTCTGGGGGAGG + Intronic
1119085105 14:71732157-71732179 CTTCTCTGAAGTACAGCTGCTGG - Intronic
1119539798 14:75430379-75430401 CTTTTCTGCCTTTCTGCTGCAGG + Intronic
1119838300 14:77770882-77770904 ATTCTCAGCTCTTCATCTGAAGG - Intergenic
1119963578 14:78887703-78887725 CTTCTCTCCTCTACAGATCCTGG + Intronic
1120033033 14:79664231-79664253 CTTCACTGCTCCTCATCTACAGG - Intronic
1121814944 14:96921994-96922016 CTTCTCTGCACTCCTGCTTCAGG + Intronic
1122305797 14:100765666-100765688 CTTTTCTGCCCTCCAGCTGCAGG + Intergenic
1123170913 14:106372104-106372126 CTCCACTGCTCTGCAGCTGATGG + Intergenic
1123194587 14:106604348-106604370 CTCCACTGCTCTGCAGCTGATGG + Intergenic
1123222548 14:106870663-106870685 CTCCACTGCTCTGCAGCTGATGG + Intergenic
1124703887 15:31944106-31944128 ATTCTCTCCTCTTCAGCTTTTGG - Intergenic
1127318039 15:57815964-57815986 CTTCTCTTCTTTTCAGCCTCAGG - Intergenic
1127613281 15:60657851-60657873 CTTCACTGCTCTTCAGGTTCTGG + Intronic
1128842812 15:70863946-70863968 CTGTGCTGCTCATCAGCTGCAGG + Intronic
1129448351 15:75634563-75634585 CCTCTCTGCCCCTCTGCTGCTGG + Intergenic
1130713941 15:86313083-86313105 CTTCTCTGGTTTTCAGCAGATGG + Intronic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1131027668 15:89158449-89158471 CTTCTCTGCTCTTCAGCTGCTGG - Intronic
1131060611 15:89401804-89401826 CAGCTCTGCTCTTCATCTGACGG + Intergenic
1131365714 15:91837552-91837574 CTCCTCTGCTCTTCTGCTTGTGG + Intergenic
1131449498 15:92527627-92527649 CTTCTCTGCACTTCAGACGGAGG + Intergenic
1131742252 15:95405913-95405935 CATCACTTCTCATCAGCTGCTGG - Intergenic
1132563615 16:610392-610414 CTGCTCTCCTCCTCATCTGCTGG - Intronic
1132579746 16:679558-679580 CTTCTCTGCTCTGCCCCTGATGG + Intronic
1132683076 16:1151867-1151889 CTTCTCTGCTGCTCACCCGCAGG + Intergenic
1133001910 16:2856111-2856133 GTTCTCTGCTCACCAGCCGCTGG - Exonic
1134609631 16:15598072-15598094 CCTCCCTGCTCTTCATCTGTTGG - Intronic
1135518689 16:23156729-23156751 CTTCCCTACTTTCCAGCTGCTGG - Intergenic
1135544980 16:23359555-23359577 CCTCTCTGCTCTCCCGGTGCTGG + Intronic
1136563813 16:31057559-31057581 CTACGCTGGTCTTCAGCTCCTGG - Intergenic
1136925805 16:34372702-34372724 ATTCTGTGCTCAGCAGCTGCAGG - Intergenic
1136978769 16:35039104-35039126 ATTCTGTGCTCAGCAGCTGCAGG + Intergenic
1137594050 16:49712208-49712230 CTTCTCTGCTCCTCACTTGGAGG + Intronic
1138283957 16:55793864-55793886 CTTCTTTGTCCTTCAGCTTCTGG - Intergenic
1138285045 16:55803123-55803145 CTTCTTTGTCCTTCAGCTTCTGG + Exonic
1139201965 16:64986956-64986978 CTTCCCTCCTCTTTAGCTACTGG + Intronic
1140434604 16:74936086-74936108 CTTCTCTGTTCTTTACCAGCAGG - Intronic
1140880762 16:79196157-79196179 CTTCTCTGTTCTTCACCTGTTGG + Intronic
1141292377 16:82731259-82731281 GTTTTCCACTCTTCAGCTGCAGG - Intronic
1142267494 16:89071201-89071223 CATCTCTTCTCCTCTGCTGCTGG + Intergenic
1143045742 17:4077922-4077944 AGTCCGTGCTCTTCAGCTGCAGG + Exonic
1143558543 17:7677530-7677552 CTTCTCTGCTAATCAACTGGTGG + Intronic
1144104412 17:11972702-11972724 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1144222729 17:13114704-13114726 CCCCTCTGCTCTTCCGCTCCTGG + Intergenic
1144231381 17:13207831-13207853 CTTCTGAGCTCTTCAGATGCTGG - Intergenic
1144324791 17:14168605-14168627 CTTGTCTTCTGTGCAGCTGCAGG + Intronic
1144702962 17:17350780-17350802 CCTACCTGCTCTTCAGCAGCGGG + Intergenic
1144809652 17:17990527-17990549 CTCCTCTGCTCTTCTGCGGCTGG + Intronic
1145994953 17:29099806-29099828 CTTCTCTGCCTTTCCTCTGCTGG - Intronic
1146234599 17:31146532-31146554 TTTCTCTGCCCTCCTGCTGCAGG + Intronic
1148736923 17:49870122-49870144 CTTCACTGCCCTTCAGGCGCGGG + Intergenic
1149104259 17:52943292-52943314 CTTGTCTGCTCATCTGCTTCTGG - Intergenic
1151007059 17:70449846-70449868 CCCCTCTGCTCTTCAGCTTTAGG - Intergenic
1152319116 17:79597997-79598019 CCTCTCTGCTCTTCAGATTGTGG - Intergenic
1152456460 17:80419632-80419654 CTTGTCAGCCCTTCTGCTGCTGG + Intronic
1152552961 17:81038917-81038939 TTTCTCTCCTCCTCAGGTGCCGG - Intronic
1152851106 17:82636514-82636536 CTTTCCCCCTCTTCAGCTGCAGG - Intronic
1152980647 18:273058-273080 CTACTCAGATCTTCAGCTGCGGG - Intergenic
1153141369 18:1976143-1976165 TTGCTCTGCTCTTCAGTTCCTGG - Intergenic
1153681478 18:7504979-7505001 CTCCTCTGCTCTTCTGCTCATGG + Intergenic
1154489867 18:14913037-14913059 CTTCTCTGCTCATCTCATGCTGG - Intergenic
1154979459 18:21490572-21490594 CTTCCATGCTCTCCAACTGCAGG + Intronic
1155811460 18:30241108-30241130 TTCCTCACCTCTTCAGCTGCTGG + Intergenic
1157259691 18:46167429-46167451 CTCCTCTGCTGTCCAGCTGCAGG + Intergenic
1157992170 18:52510319-52510341 CTTCTCTGCATTCCAGCTGCGGG + Intronic
1159271607 18:66159996-66160018 CTTTTTTGCACTTCAGCTGGTGG + Intergenic
1159959667 18:74545663-74545685 CCTCTCTGCTGTTCTGCGGCCGG + Intronic
1160957929 19:1702458-1702480 CTTCTCTTCTCTTTAGATACAGG - Intergenic
1161857520 19:6773998-6774020 CCTCCCAGCTCTTCATCTGCAGG - Intronic
1162457847 19:10796629-10796651 CTTCTCTGTCCCTCAGCTCCGGG + Intronic
1162769949 19:12943415-12943437 CTTGTCTTCTCTGCAGATGCAGG + Intronic
1163900506 19:20095795-20095817 CTTCTCTGCTTTTCTGGGGCAGG - Intronic
1163906816 19:20155481-20155503 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1165020638 19:32921381-32921403 ATTCACTGCCCTCCAGCTGCAGG - Intronic
1165485564 19:36093480-36093502 GTTTTCTTCTCTTCTGCTGCTGG + Intronic
1165497189 19:36160044-36160066 CTTCTCTGCTCTTCTGGGGCAGG - Intergenic
1165510532 19:36264257-36264279 CTTCTCTGCTCTTCTGGGGCAGG - Intergenic
1166159259 19:40939495-40939517 GATCTCTGCTCTTCTGCTCCTGG + Intergenic
1166919972 19:46222602-46222624 CTGCTCTACCCTGCAGCTGCAGG + Intergenic
1168170797 19:54587336-54587358 CCTCTCTGCTGTTCACCTCCCGG - Exonic
1168186154 19:54700895-54700917 CCTCTCTGCTGTTCACCTCCCGG - Intronic
925497927 2:4472985-4473007 CTTCCCTGCTCCTCAGCTTGGGG - Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
925809353 2:7683702-7683724 CTTTACTTCTCTCCAGCTGCTGG - Intergenic
925877336 2:8323935-8323957 CTATTCTTATCTTCAGCTGCAGG + Intergenic
925881009 2:8352840-8352862 TTTCTCTTCTCTTCAGCTTTGGG - Intergenic
926142044 2:10373629-10373651 CTTCTCTATTCTTGAGGTGCTGG + Intronic
926949111 2:18222006-18222028 CTCCTCTCCTCTTGAGCTGGTGG + Intronic
928441422 2:31295387-31295409 CTTGTCTGCTCGTCTGCTTCTGG - Intergenic
928519393 2:32073904-32073926 CTTTTCTGCTCTTCTGCAGAGGG + Intronic
928866448 2:35922547-35922569 CTTCTCTTCCCTTCTGCTACAGG + Intergenic
929001247 2:37349134-37349156 CTTCTCTGTCCTTCAGTTACTGG + Intronic
929234367 2:39590755-39590777 TTTCTGTGCTATTCAGCTGCAGG + Intergenic
930818930 2:55626199-55626221 CATTTCTGCTCTTCCACTGCAGG - Intergenic
932323335 2:70837954-70837976 CATCTCTGCCCTTCTGCTCCTGG + Intergenic
932974181 2:76578704-76578726 CTTCTCTGCTTTTCTGGGGCAGG - Intergenic
933418158 2:82013794-82013816 CTTGTCTGGGCTACAGCTGCTGG - Intergenic
933593548 2:84260097-84260119 CTTCTTTGATCTTGAGCTGGGGG - Intergenic
933674831 2:85045417-85045439 CTTCTCAGTTTTTCAGCTGATGG - Intronic
933743764 2:85555116-85555138 CTTCTCAGTACATCAGCTGCAGG + Intronic
934638177 2:96009934-96009956 CTGCTCAGCTCTTCGGCTGCCGG - Intergenic
934795474 2:97095476-97095498 CTGCTCAGCTCTTCAGCTGCCGG + Intergenic
934831107 2:97526064-97526086 ATTCTCAGATCTCCAGCTGCAGG - Intronic
935391610 2:102559017-102559039 TTTCTCTGCTCTCCAGCTGCAGG + Intergenic
935713104 2:105916670-105916692 CTCCACTGCTCCTCTGCTGCGGG + Intergenic
936164166 2:110105476-110105498 CTTCTCTTCTGTTCTCCTGCAGG - Intronic
936366105 2:111857802-111857824 CTTATCTGTTCATCAGCTGACGG - Intronic
936883135 2:117279723-117279745 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
938760289 2:134419181-134419203 CTTTTCTTCTCTTCAACTGAAGG - Intronic
939057187 2:137380017-137380039 GTTCTTTGCTCTTAAGCTTCAGG + Intronic
940043928 2:149389600-149389622 CTTCCATGCTATTCAGATGCAGG - Intronic
941259203 2:163274753-163274775 CTACTCTGCCCTTTAGCTCCAGG - Intergenic
941523272 2:166575739-166575761 CTTTTCTGTTCTTCAGTTTCTGG + Intergenic
941752113 2:169144425-169144447 CTTCCCTGAGCATCAGCTGCCGG + Intronic
942036835 2:172018350-172018372 ATTATCTGCTTTTCAGCTTCTGG - Intronic
942276306 2:174326462-174326484 CTCCTCTCCTCCGCAGCTGCGGG - Intergenic
942713932 2:178869769-178869791 CTACTATGCTGTTCAGCTGGTGG - Intronic
942732352 2:179074296-179074318 CTTCTTTGCTCCTCAGCTTGCGG + Intergenic
944403828 2:199360151-199360173 GTTCTCTGATTTTCACCTGCTGG + Intronic
944913922 2:204338094-204338116 CTTCTCAGATCTTGAGCTGGAGG - Intergenic
946362603 2:219228467-219228489 CCTCGATGCTCTGCAGCTGCTGG + Exonic
948051473 2:234982461-234982483 CTCCTGTGCCCTCCAGCTGCTGG - Intronic
948385309 2:237577217-237577239 CTGCTCTGCTCTTCCACAGCAGG - Intronic
948523392 2:238556406-238556428 CTTCTCTGCTCTTTGGCTTCTGG + Intergenic
948936590 2:241169195-241169217 CTTCTCTGCACTTATGCTCCCGG + Intronic
1169427078 20:5504699-5504721 CTTCTCGGCTCTTCCTCTCCGGG - Intergenic
1169556552 20:6757212-6757234 CTTTTCTGACCTTCAGCTGTAGG + Intergenic
1170831132 20:19841618-19841640 CTTCCCTGATTTTCAGCTGTGGG - Intergenic
1171001883 20:21423335-21423357 CTTGTCTTCTGCTCAGCTGCAGG + Intergenic
1171349606 20:24492512-24492534 CTTCTCTTTTCTTCAGAGGCTGG + Intronic
1171952251 20:31430866-31430888 CTTCTCTGCTAATCTCCTGCTGG + Intergenic
1172099189 20:32475340-32475362 CTTCTCTGCACTTCTGGGGCTGG - Intronic
1172807890 20:37626001-37626023 AGTCTCTCCTCTTCATCTGCTGG - Intergenic
1172889385 20:38253155-38253177 CTTCTCTGACCTTGGGCTGCAGG - Intronic
1173766857 20:45619234-45619256 CTCCTCAGCTCTCCAGCAGCTGG - Intronic
1175867288 20:62186004-62186026 CTTCTCTGCGGTTGATCTGCAGG + Intronic
1175913226 20:62414372-62414394 CTTCTCTGGCCTTCAGGTCCTGG + Exonic
1176012540 20:62906963-62906985 CTTCTCTGCCCGTTAGCTGAGGG - Intronic
1177027316 21:15935653-15935675 CATCTCTTTTCTTCAGCTCCAGG - Intergenic
1177302566 21:19268597-19268619 CTTCTCTGCTGTTCGGGTACTGG - Intergenic
1177718052 21:24866158-24866180 TTTTTCTGCTCTTCTGCTCCAGG - Intergenic
1177803231 21:25848681-25848703 CTTGTCTTCTCTGCACCTGCAGG - Intergenic
1178723859 21:35034290-35034312 CTTCTCTGCTCTTCACGTCGGGG + Intronic
1179070585 21:38067217-38067239 TTTCTTGCCTCTTCAGCTGCTGG + Intronic
1179387095 21:40954068-40954090 CTTCTCTACTTTTGAGTTGCAGG + Intergenic
1179908490 21:44436128-44436150 CTCCTCTGCACTCCAGCAGCTGG + Intronic
1180642461 22:17310238-17310260 CTTCTCTGCCCTCCAGTTCCTGG + Intergenic
1180948113 22:19707946-19707968 CTTCACAGCCATTCAGCTGCAGG - Intergenic
1181408059 22:22698671-22698693 CTTCCCAGCTCTTCAAATGCAGG + Intergenic
1181412716 22:22735339-22735361 CTTCCCAGCTCTTCAAATGCAGG + Intronic
1181420346 22:22793253-22793275 CTTCCCAGCTCTTCAAATGCAGG + Intronic
1182181307 22:28351641-28351663 TTTTTCTGCTCTTCAGCTTGAGG - Intronic
1183074413 22:35417728-35417750 CCCCTCTGCTCTCCAGATGCTGG + Exonic
1183779161 22:39987814-39987836 CTTCTCGGATCTTCGCCTGCTGG - Intergenic
1184027712 22:41870268-41870290 CATCTCTGCTCTGCTCCTGCTGG + Intronic
949159181 3:859816-859838 CTTCCCGAGTCTTCAGCTGCAGG + Intergenic
949255366 3:2038846-2038868 CTGCTTTGTTCTTCAGCTGCAGG - Intergenic
949759947 3:7459338-7459360 CCTCTCTGCTCCCCACCTGCTGG - Intronic
950335147 3:12187481-12187503 CTCCTCGGCTCCTCAGCGGCCGG + Exonic
950340882 3:12243180-12243202 CCTCTCTGTTTTTCACCTGCTGG + Intergenic
950448890 3:13054665-13054687 CTTCTCTGCGCCTCAGCCTCAGG - Intronic
950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG + Intronic
951325240 3:21294590-21294612 CATCTCTGATCTTCAGTTTCAGG - Intergenic
952167898 3:30771181-30771203 ATTCCCTGCCCTTCAGCTGAAGG + Intronic
952674711 3:36013688-36013710 CCTCTCAGGTCTGCAGCTGCAGG - Intergenic
953829684 3:46285292-46285314 CATCTCTCCTCTTCAACTCCTGG + Intergenic
953967695 3:47322658-47322680 CTTTGATGCTCTGCAGCTGCAGG - Exonic
954331913 3:49895734-49895756 CTGCACTGGTCTTCAGCTACTGG - Exonic
955405381 3:58622629-58622651 CTTCTCTGCATTCCAGCCGCAGG - Intronic
956477961 3:69643300-69643322 TTTTTCTGCTCTTCAGCTTTTGG + Intergenic
956699751 3:71948475-71948497 CTGCTCTGCTCTGCAGCTCAGGG - Intergenic
957008200 3:74974660-74974682 CATCCCTCCTCTTCAGGTGCTGG + Intergenic
959092278 3:101916633-101916655 CTTCTCGGCTTTTCCACTGCTGG - Intergenic
959289949 3:104460931-104460953 TTTCTCTGCCCTCTAGCTGCAGG + Intergenic
959773972 3:110134711-110134733 CTTCTCTGCTCTTCTGCTCATGG - Intergenic
961711812 3:128833847-128833869 CTTCTCTGCTCTTCTGGGGCAGG - Intergenic
962388601 3:134953221-134953243 CTGCTTGGCACTTCAGCTGCAGG - Intronic
963120170 3:141769609-141769631 CTTCTCTGATCTGTATCTGCAGG + Intergenic
963589352 3:147236844-147236866 ATTCTCTGCTCTTTTGCTGCTGG - Intergenic
964304903 3:155329295-155329317 CTGCTTTGCTCTTGAGCTCCAGG + Intergenic
964484552 3:157174502-157174524 TTGCTCTGCTCTTCATCTTCTGG + Intergenic
964710953 3:159671076-159671098 CTGCTCTGTTCATCAGCAGCAGG - Intronic
966040781 3:175485427-175485449 CTTCCTTGCTCTTCAGCTTACGG - Intronic
967523245 3:190460679-190460701 TTTCTGTGCTCATCAGCTGATGG + Intergenic
968064399 3:195750530-195750552 CGTCTCTGCTCTCCAGCGGGAGG - Intronic
968308970 3:197667322-197667344 CGTCTCTGCTCTCCAGCGGGAGG + Intergenic
968966703 4:3772518-3772540 CTCCTCTGCTCCTCAGCTCTAGG - Intergenic
971110872 4:23584512-23584534 CTCCTATGCTCTTCAGCTGAAGG - Intergenic
972557436 4:40195057-40195079 GTTCTATGCTCTTCAGCAACTGG - Intronic
972563068 4:40245957-40245979 CTTCTCTGCTCTCCAGGCGGTGG + Exonic
973193146 4:47409537-47409559 CTCCTCTGCTCTTCTGCTCATGG + Intronic
973832854 4:54779377-54779399 TTTCTCTGCACCTCAGCTGATGG - Intergenic
973844308 4:54894899-54894921 CTACTCTGCTCTGTGGCTGCTGG + Intergenic
977753327 4:100635260-100635282 CTTCTCTGCTCCTCAAGTGGAGG - Intronic
978276739 4:106960086-106960108 TTTCTCTGCACATCAGCTGATGG - Intronic
979155353 4:117380973-117380995 ATTCTCTAGTCTTCAGCTTCTGG + Intergenic
979259937 4:118636316-118636338 CCTCACTGATCTTCAACTGCAGG - Intergenic
979600934 4:122585998-122586020 CTCATCTGCTCTTCTGCTTCTGG - Intergenic
981362751 4:143866393-143866415 CTCCTCTGATCTTCTGCTGTTGG - Intergenic
981411984 4:144442700-144442722 CTTGTCTTCTCTGCACCTGCAGG + Intergenic
981622242 4:146715045-146715067 CTACTCTGCTCTTGAACTCCTGG + Intronic
983459558 4:168011202-168011224 CTTCCCTGTTCTTCAGCTTGCGG + Intergenic
984653315 4:182291757-182291779 GTGCTCTGCTCCTCAGCTTCTGG - Intronic
985525434 5:399076-399098 CTTGTCTGCTCTGAAGCAGCTGG + Intronic
985733765 5:1565752-1565774 CTCCTCTGCCCTCCAGCTGATGG - Intergenic
985989013 5:3539768-3539790 CTTCTCTGCTCTGCATCTCAGGG + Intergenic
986285433 5:6355156-6355178 CATCACTGCTCTTTAGCTGTAGG + Intergenic
987281814 5:16420892-16420914 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
987550518 5:19374302-19374324 CTTCTCTGCTAGACATCTGCAGG + Intergenic
992002961 5:72452981-72453003 CTTCTCGGCTCTTTTGCTGTTGG - Intronic
992147406 5:73865147-73865169 CTACTCTGATCTTCATTTGCAGG - Intronic
992295990 5:75327438-75327460 CATACCTCCTCTTCAGCTGCAGG + Intergenic
993698883 5:91094819-91094841 CTTCACTTCTCTTAAGCTCCAGG - Intronic
994551631 5:101241243-101241265 CTTCTCTGCACTACTGCTGGAGG - Intergenic
995073163 5:107948463-107948485 CTTCTCTGCTGTTCTTCTCCAGG + Intronic
995132467 5:108644850-108644872 GCTCTGTGCTCTTCTGCTGCAGG - Intergenic
996027012 5:118657609-118657631 CTTGTCTTCTGTTCACCTGCAGG + Intergenic
996038914 5:118788716-118788738 CTTCTCTTTTCTTCAGCTGTGGG - Intergenic
996186242 5:120478829-120478851 CTTCTCTGTTTTTCTGCTTCTGG + Intronic
996220508 5:120926672-120926694 CTACTTCTCTCTTCAGCTGCAGG + Intergenic
996708903 5:126524555-126524577 CCTCTCTGCCCTGCAGCTGGTGG - Intergenic
996710140 5:126535657-126535679 CTCCTCTGCTCTTCTGCTCGTGG + Intergenic
996875936 5:128240432-128240454 CTTCTCACCTCTTCTACTGCCGG - Intergenic
997828016 5:137124780-137124802 CAGCTCTCCTCTGCAGCTGCAGG - Intronic
999243947 5:150143570-150143592 CTTTCCTACTCTTTAGCTGCTGG - Intronic
999383908 5:151140902-151140924 CCGCTCTGCTCTCCAGCTCCAGG + Intronic
1000195745 5:158955851-158955873 CTACTCTTCCTTTCAGCTGCTGG - Intronic
1001044443 5:168361122-168361144 CTTGTCTGCTCTATACCTGCAGG + Intronic
1001051314 5:168416630-168416652 AATCTGTTCTCTTCAGCTGCTGG - Intronic
1002050143 5:176565896-176565918 GTTTTCTTCTCTTCAGCTTCTGG + Intronic
1003133839 6:3417835-3417857 CTGCTCTGCTCTGCAAATGCAGG + Intronic
1003475523 6:6478580-6478602 CTTCTCTGCCCTTGAACTGATGG + Intergenic
1004313109 6:14563438-14563460 TTTTTCTGCTCTGCTGCTGCAGG - Intergenic
1005188904 6:23195656-23195678 CTTTTCTGCTCTTCAGTTTTTGG + Intergenic
1005189540 6:23204583-23204605 CTGCCCTGCTCCTAAGCTGCGGG - Intergenic
1007073192 6:39050840-39050862 CTTCCCTGCTCCTGAACTGCTGG - Intronic
1007363549 6:41374624-41374646 CTGCGCAGCTCTTCTGCTGCCGG + Intergenic
1007481420 6:42152853-42152875 CTTCTCTGCTCTTAAGGTGCAGG - Intergenic
1007704866 6:43784412-43784434 CCTCTCTGCTCTTATGGTGCCGG + Intronic
1008406317 6:51122087-51122109 ATTCTCAGATCTCCAGCTGCGGG - Intergenic
1008794172 6:55280216-55280238 CTCCTGTCCTCTTCAGTTGCAGG - Intronic
1010168432 6:72944754-72944776 TTGCTCTGTCCTTCAGCTGCTGG - Intronic
1011612659 6:89168499-89168521 CTTCTCTGACATTCAGCTACAGG - Intergenic
1012129263 6:95470549-95470571 ATTCTCTGCTCTGCAACAGCTGG + Intergenic
1012382432 6:98636018-98636040 CTTCTCTGCCCTCCAGGAGCTGG + Intergenic
1013474232 6:110492899-110492921 CTCCTCTGCTCTAGAACTGCAGG + Intergenic
1013476101 6:110508670-110508692 CTTGTCTGCTCATCTGCTTCTGG - Intergenic
1013722248 6:113044342-113044364 CTTCTTGGCTCTACAGCAGCTGG + Intergenic
1015839906 6:137466096-137466118 CTCCTCTGCTCTTCTGCTTGCGG + Intergenic
1016518624 6:144924249-144924271 CTTCTCTGCTCTTCTGGGGCAGG + Intergenic
1017107716 6:150903800-150903822 ATTCCCTGCTTTTCAGCTTCTGG - Intronic
1018569538 6:165194643-165194665 CTTCCCTGCTCCTCAGCTTGCGG + Intergenic
1018814738 6:167322160-167322182 CTTCCTGGCTCTTCAGCTTCCGG + Intergenic
1018966524 6:168494771-168494793 CTCCCTTGCCCTTCAGCTGCTGG - Intronic
1019598023 7:1867349-1867371 CTTCTCTCCTCTACATCTTCCGG - Intronic
1023210870 7:37803852-37803874 CCTCTCTGCTCTTCATCCCCTGG + Intronic
1023525053 7:41093279-41093301 CTTCTAAGCTCTTCACATGCTGG + Intergenic
1024240979 7:47435624-47435646 CTCATCTGCTCTTCTGCAGCTGG + Intronic
1024614165 7:51094211-51094233 CTCCTCTACTCCTCAGCTTCTGG - Intronic
1024617529 7:51128181-51128203 CTTCTTTGCTCTTCTTTTGCAGG + Intronic
1025770515 7:64501014-64501036 CTTCTCTCTTCTACAGCAGCCGG - Intergenic
1025971296 7:66328408-66328430 CTACTCAGCTCTACTGCTGCAGG - Intronic
1026231892 7:68491097-68491119 CATCTCTGCTTTGCAGCTGTTGG - Intergenic
1026592244 7:71706945-71706967 CTCTTCTGCTGCTCAGCTGCTGG + Intronic
1028617152 7:92781274-92781296 GTTCTCTGCCCTGCAGCTGGCGG - Intronic
1029017256 7:97327348-97327370 TTTCTCTGCTTGTCAGCTTCTGG - Intergenic
1030533506 7:110737714-110737736 CTGATGTGCTCTTCAGCTCCTGG + Intronic
1030860272 7:114616652-114616674 GTTCTCTGCTCTTATTCTGCAGG + Intronic
1031336544 7:120540104-120540126 CTAGGCTGGTCTTCAGCTGCTGG + Intronic
1031525332 7:122817686-122817708 CTTCTCTGCTTTTCTGCGGGAGG + Intronic
1032548054 7:132759757-132759779 CTTCTCTGCTCCTCACCAGGAGG + Intergenic
1033457694 7:141517525-141517547 CTCCCCTGCTCTTCACCTACGGG - Intergenic
1033614961 7:143005050-143005072 CATTTCTGCTCTCCACCTGCAGG + Intergenic
1033658724 7:143389742-143389764 CTTCTCTGCCCTGCATCTCCAGG - Intronic
1035012324 7:155730178-155730200 TCTCTCTGCCCTTCAACTGCCGG - Intronic
1035337662 7:158140465-158140487 CTTATCCGCTCTCCTGCTGCCGG - Intronic
1035526198 8:315177-315199 CTTCTCTGCTTTTCAGCCTCTGG - Intergenic
1036652357 8:10653361-10653383 GTTCTCTGCTCCTCTGCTCCTGG - Intronic
1037499877 8:19475279-19475301 CTTCTTGGCCCTTCAGCTTCAGG - Intronic
1039408142 8:37330070-37330092 TTTCTCTGTTCTTCAGCAGAAGG - Intergenic
1039899773 8:41743147-41743169 CTTCTCTCCTACTCTGCTGCAGG - Intronic
1040780363 8:51100364-51100386 CTTTTCTCCTCCTCAGCTCCTGG - Intergenic
1042112537 8:65395959-65395981 TTTCTCTGCTCTTCGTCTCCTGG - Intergenic
1042359503 8:67866773-67866795 CTTCTCTGCCATCCAGCTGCTGG + Intergenic
1042360927 8:67882349-67882371 CAGCTCTGCTCTTCCCCTGCTGG + Intergenic
1042455544 8:68998327-68998349 CTTCTCTGCTCCTAGGCTGAAGG + Intergenic
1043122403 8:76343899-76343921 CTCCTCTGCCCTGCAGCTGGTGG - Intergenic
1044300090 8:90573599-90573621 CTCCACTGTTCTTCAGCTGTGGG + Intergenic
1044387438 8:91606105-91606127 CTTCTCTGCTCTGAATCTTCAGG - Intergenic
1045051145 8:98327104-98327126 CTTCTCATTTCTTCAGCTGAGGG + Intergenic
1045228912 8:100281120-100281142 CTTCTCTATCCTTCAGCTGAAGG + Intronic
1045675869 8:104607584-104607606 CTTCTCTTCTGTGCACCTGCAGG - Intronic
1047699128 8:127432641-127432663 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1047764335 8:127977996-127978018 CTGCTCTGCTCATCAGATGCTGG - Intergenic
1048347283 8:133585915-133585937 CCTCTGTGCTCTGCAGCTTCCGG - Intergenic
1048707098 8:137165991-137166013 TTTCTCTGCCATACAGCTGCAGG - Intergenic
1048708337 8:137180027-137180049 CTTATTTGCTGTTCAGCTGTAGG - Intergenic
1048786650 8:138057593-138057615 TTTCTCTGATCTTCATGTGCTGG + Intergenic
1048863096 8:138738213-138738235 CGTTTCTGCTCTTCTGCTGTGGG + Intronic
1049252861 8:141598471-141598493 GACCTCAGCTCTTCAGCTGCAGG + Intergenic
1049424623 8:142532606-142532628 CTCCTCTGCTCCTCCCCTGCTGG + Intronic
1050077031 9:1876062-1876084 CTTCTCTGCTGGCCAGCTGGTGG + Intergenic
1050409984 9:5353763-5353785 CTTCTCTGCACTTGAGGTGGAGG - Intergenic
1052113487 9:24619253-24619275 CTCCTCTGCTCTTCTGCTCATGG + Intergenic
1052645590 9:31229988-31230010 ATTCTCAGATCTCCAGCTGCGGG + Intergenic
1052769705 9:32676303-32676325 ATTCTCTGCTCCTCCTCTGCAGG - Intergenic
1053576153 9:39358434-39358456 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1053840670 9:42186371-42186393 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG + Intergenic
1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054588626 9:66989807-66989829 CTTCACTGCTCCTCCCCTGCGGG - Intergenic
1055232820 9:74086538-74086560 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1056066401 9:82939989-82940011 CTTCTCTACTGTGTAGCTGCCGG - Intergenic
1056322153 9:85445592-85445614 TTTCTCTGCTCTTCTGCTCCAGG - Intergenic
1056544635 9:87603408-87603430 CTTCTCAGCTATCCTGCTGCAGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058860779 9:109116182-109116204 CTATACTGCTCTTCAGCAGCAGG + Intronic
1060110490 9:120903341-120903363 TTCCTCTGATCTTCAGCTGAAGG + Exonic
1060440646 9:123636099-123636121 TTTCTCAGCTCTGCAGCTCCAGG + Intronic
1061759075 9:132837368-132837390 CTGCTCTGCCCTTCTGCTGTGGG + Intronic
1062436820 9:136550056-136550078 CTTCCCTGCTCTGCTGTTGCAGG + Intergenic
1185960908 X:4545211-4545233 CTTCTCTGCTTTTCTGGGGCAGG - Intergenic
1187610129 X:20933569-20933591 CCTCTATGATCTTCAACTGCAGG - Intergenic
1188007378 X:25024748-25024770 TTTCTCTCTTCTTCAGCTTCTGG + Intergenic
1190483098 X:50897328-50897350 CTTGTCTGCTCATCTGCTTCTGG + Intergenic
1191976821 X:66881928-66881950 ATTCACTCCTCTTCAGCTACTGG - Intergenic
1193096737 X:77556957-77556979 ACTATCTGCTTTTCAGCTGCTGG + Intronic
1193233623 X:79078350-79078372 GTTCTCTTTTCTCCAGCTGCAGG - Intergenic
1194351061 X:92825400-92825422 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1195071355 X:101283577-101283599 CTTTACTTCTCTTCAGCTGATGG - Exonic
1196673999 X:118400217-118400239 CTTCTCTGGCCATCAGCTGATGG - Intronic
1198210204 X:134509115-134509137 CTTCACTGCCCTTCTGCTCCTGG + Intronic
1199198178 X:145057023-145057045 TTTTTCTGCCCTTCAGCTGCAGG - Intergenic
1200159020 X:153995136-153995158 CTTCTCTGCTCAGCTGCTGGTGG - Intergenic
1201397461 Y:13564624-13564646 GTTCTCAGATCTCCAGCTGCGGG + Intergenic
1201590715 Y:15611537-15611559 GTTCTCAGATCTCCAGCTGCAGG - Intergenic
1201936861 Y:19419399-19419421 CTTCTCTGCTTTTCTGGGGCAGG + Intergenic
1202379069 Y:24260678-24260700 CCTCTCTGAGCCTCAGCTGCTGG - Intergenic
1202491713 Y:25409443-25409465 CCTCTCTGAGCCTCAGCTGCTGG + Intergenic