ID: 1131029753

View in Genome Browser
Species Human (GRCh38)
Location 15:89176559-89176581
Sequence TCATCCTGTGGGGCATCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131029753_1131029760 -6 Left 1131029753 15:89176559-89176581 CCAGTAGATGCCCCACAGGATGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1131029760 15:89176576-89176598 GGATGAGTCCCAGGAGGGCGTGG 0: 1
1: 0
2: 2
3: 40
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131029753 Original CRISPR TCATCCTGTGGGGCATCTAC TGG (reversed) Intronic
900364166 1:2304036-2304058 TCCTCCTCTGGGGCAGCCACGGG - Exonic
904292430 1:29496832-29496854 TCATCATGTGGGTCCTCTCCTGG + Intergenic
904321309 1:29699205-29699227 TCATCCTGTTGGTTATCTCCGGG + Intergenic
906940924 1:50254692-50254714 GCATACTGTGGGGCCTCTACAGG - Intergenic
909248934 1:73327368-73327390 TCATCCAGTGGGACATCTAGTGG - Intergenic
911822600 1:102439954-102439976 TCCTCCTGTGGTGGATCTAAGGG - Intergenic
919253850 1:195096411-195096433 TCATGCTGAGGGGCACCTGCAGG - Intergenic
924948779 1:248863855-248863877 TCATGCTGAGGGGCACCTGCAGG - Intergenic
1066458611 10:35594164-35594186 CCATTCTGTGAGGCAGCTACAGG - Intergenic
1067475562 10:46563687-46563709 TTATCCTCTGGGGCAAGTACAGG - Intergenic
1067619174 10:47778088-47778110 TTATCCTCTGGGGCAAGTACAGG + Intergenic
1069774212 10:70917463-70917485 TCAGCCTGAGGAGCATCCACAGG + Intergenic
1070489666 10:76964806-76964828 TTATCCTCTTGGGCATCTCCTGG - Intronic
1077376354 11:2206585-2206607 TCTTCCTTTGGGCCATGTACAGG - Intergenic
1087094985 11:94309291-94309313 TCATACTTTGGGGCCTCCACTGG - Intergenic
1091308203 11:134554299-134554321 TCAGCCTGTGGGCCAGGTACCGG - Intergenic
1095437798 12:42210430-42210452 TCTTCCTGATGGGCATCCACTGG + Intronic
1095872571 12:47046494-47046516 GCATCCTCTGGGGCCTCTATGGG + Intergenic
1107582856 13:41810271-41810293 TCTTTCTGTTGGGCATATACCGG - Intronic
1107617170 13:42181696-42181718 CCCTGCTGTGGGGCATATACTGG - Intronic
1108844389 13:54660100-54660122 TCATGCTGAGGGGCGTCTGCAGG + Intergenic
1109470607 13:62799376-62799398 TCATGCTGAGGGGCACCTGCAGG - Intergenic
1110238751 13:73243796-73243818 CCATCCTTTGTGGCATCTAAAGG - Intergenic
1111595334 13:90403879-90403901 TCATGCTGAGGGGCACCTGCAGG - Intergenic
1113708431 13:112448666-112448688 ACATTCTGTGGGGCATGCACGGG - Intergenic
1115522098 14:34243199-34243221 TCATGCTGTGGGGTAGCTGCGGG + Intronic
1118770754 14:68941081-68941103 TCGTCCTCTGGGGCCTCCACAGG - Intronic
1125514675 15:40311379-40311401 TCTTCCTCCTGGGCATCTACAGG - Intergenic
1128684023 15:69670688-69670710 TCATTTTGTGGGGCATCTCTGGG + Intergenic
1131029753 15:89176559-89176581 TCATCCTGTGGGGCATCTACTGG - Intronic
1132471285 16:104853-104875 TCTTACTGTGGGGGATTTACAGG - Intronic
1134011048 16:10853385-10853407 TCATCCTCCGTGGCAGCTACAGG - Intergenic
1135783996 16:25331680-25331702 TCAACTTGTGGAGCATCTTCTGG + Intergenic
1135885232 16:26299992-26300014 TCTTCTTGTGGGACTTCTACAGG + Intergenic
1139150935 16:64381273-64381295 TCATGCTGAGGGGCACCTGCAGG - Intergenic
1142561593 17:812494-812516 ACATCCTGTGGGGCTTCTCTGGG - Intronic
1148102682 17:45102292-45102314 TGATCCTGTGGAGCAAATACCGG - Intronic
1151957387 17:77387188-77387210 TGATCCTTTGGGGCCTCTGCGGG + Intronic
1152804781 17:82350445-82350467 GCATCATGTGTGGCATCTGCAGG + Intergenic
1153723944 18:7936585-7936607 TCATGCTGAGGGGCACCTGCAGG - Intronic
1156032191 18:32725497-32725519 TCCTCCAGTGGAGCATCTGCTGG - Intronic
1162017179 19:7852057-7852079 TCAGGCTTTGGGGCATCTGCGGG - Intronic
1163845245 19:19634918-19634940 TCACCCTGCAGGGCATTTACCGG - Exonic
1165433785 19:35786207-35786229 ACAGCCTGTGGGGCAGCCACAGG + Intronic
925932394 2:8719560-8719582 TCTTCCTCTGGGTCATCTTCTGG - Intergenic
935388218 2:102523585-102523607 TCACCCTGTGGGGCATCTTGTGG + Intronic
936220561 2:110599140-110599162 ACATCCTGTGGAGTATGTACGGG - Intergenic
946756612 2:222953779-222953801 TCCTGCTGTGGGGCATCTATGGG + Intergenic
1173664861 20:44756329-44756351 TGATCGTGTGGGGGAACTACGGG - Exonic
1174221307 20:48957741-48957763 TCCTGCTTTGGGGCCTCTACTGG + Intronic
1174280155 20:49433505-49433527 TCATCCTGGCAGGCATCAACTGG - Intronic
1178317494 21:31578772-31578794 TCCTCCTCTGGGGCATCCATAGG + Intergenic
1182012490 22:27012272-27012294 TCATCCTCTCTGACATCTACTGG - Intergenic
1182658751 22:31910298-31910320 TCATTCTGTGGGCCTTCTGCTGG - Intergenic
1183905086 22:41034481-41034503 TCATCATTTGGGGCTTCTCCTGG + Intergenic
949470984 3:4396412-4396434 TCATCCTGTGGAGTCTCTGCAGG - Intronic
949940850 3:9153020-9153042 TGAGCATGTGGGGCATTTACTGG - Intronic
953847889 3:46443310-46443332 TCATCCTGTGGGTCAGCTCATGG - Intronic
959813721 3:110650703-110650725 TCATCCTGTAAGACTTCTACTGG - Intergenic
963250153 3:143095626-143095648 TCATGCTGAGGGGCACCTGCAGG - Intergenic
970831949 4:20350361-20350383 TCATGCTTTGGGAAATCTACTGG - Intronic
976647309 4:87399793-87399815 TCATGCTGAGGGGTACCTACAGG - Intergenic
985511473 5:316384-316406 TCATCCTGTGGATCAGCTGCCGG + Intronic
988607234 5:32689303-32689325 TCATTCTGTGAGGCTTCTGCTGG + Intronic
990605827 5:57408779-57408801 CCATGCTGTGGTGCTTCTACTGG + Intergenic
999234439 5:150082031-150082053 TCAGCCTGTGGCCCTTCTACAGG + Intronic
1006398065 6:33799972-33799994 TCATCCTGTGGGGAGTGTGCTGG + Intronic
1006830269 6:36964115-36964137 TCCTCCTGGGAGGCGTCTACAGG + Intronic
1008231571 6:48990019-48990041 TCATGCTGAGGGGCACCTGCAGG - Intergenic
1016845778 6:148566744-148566766 TCATCCAGAGAGGCATCTAAAGG + Intergenic
1023325051 7:39045281-39045303 TCATGCTTTGGGGCATGTAAAGG - Intronic
1023700069 7:42883670-42883692 TCATGCTGAGGGGCACCTGCAGG + Intergenic
1024024528 7:45399598-45399620 TCGTTCTGAGGGGCACCTACAGG - Intergenic
1029032517 7:97483685-97483707 TCAGCCTCTGGGGCATTGACAGG + Intergenic
1034271526 7:149805536-149805558 TCCTCCTGGGTGGCATCTCCTGG - Intergenic
1034708589 7:153170708-153170730 CCATCCAGTGGGCCATCTAGGGG - Intergenic
1034930198 7:155155407-155155429 CCAGCCTGGGGGGCATCAACAGG - Intergenic
1035262479 7:157670775-157670797 TCAGCCTGTGGGGCCTCTCAAGG - Intronic
1043348695 8:79332111-79332133 TCTTTCTGTGGTGCATCTCCAGG - Intergenic
1044879864 8:96712698-96712720 TGATTCTGTGGGCCATGTACAGG - Intronic
1047340669 8:123977446-123977468 TGATCCTGTGTGGCATGAACAGG + Exonic
1050082285 9:1927985-1928007 TCACCCTCTGGGGCCTCCACAGG + Intergenic
1052912953 9:33900207-33900229 CCACTCTGTGGGTCATCTACAGG - Exonic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1057745826 9:97750155-97750177 GAATCCTGTGCGGCCTCTACAGG - Intergenic
1061800124 9:133109122-133109144 TCCTCCTGCCGGGCATCTGCAGG + Intronic
1191171795 X:57454954-57454976 TCATCTTGTGTAGTATCTACAGG - Intronic
1197893358 X:131286996-131287018 CCATCCTGTGGAGCTTCTGCAGG - Intronic
1201053008 Y:9959341-9959363 TCAAGTTATGGGGCATCTACAGG + Intergenic