ID: 1131032253

View in Genome Browser
Species Human (GRCh38)
Location 15:89196056-89196078
Sequence CCTCTCCGAGGGGAGGGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131032253_1131032262 -5 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032262 15:89196074-89196096 AGAGGCTGATTCACTGGGTCTGG 0: 1
1: 0
2: 9
3: 134
4: 656
1131032253_1131032263 -4 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032263 15:89196075-89196097 GAGGCTGATTCACTGGGTCTGGG 0: 1
1: 0
2: 4
3: 118
4: 686
1131032253_1131032266 8 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032266 15:89196087-89196109 CTGGGTCTGGGAAGGAGCCTGGG 0: 1
1: 1
2: 8
3: 74
4: 590
1131032253_1131032264 0 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032264 15:89196079-89196101 CTGATTCACTGGGTCTGGGAAGG 0: 2
1: 17
2: 122
3: 562
4: 1607
1131032253_1131032261 -10 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032261 15:89196069-89196091 CTCGGAGAGGCTGATTCACTGGG 0: 1
1: 0
2: 0
3: 25
4: 209
1131032253_1131032267 9 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032267 15:89196088-89196110 TGGGTCTGGGAAGGAGCCTGGGG 0: 1
1: 0
2: 9
3: 66
4: 670
1131032253_1131032265 7 Left 1131032253 15:89196056-89196078 CCAGGTCCCTCCCCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1131032265 15:89196086-89196108 ACTGGGTCTGGGAAGGAGCCTGG 0: 1
1: 1
2: 4
3: 55
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131032253 Original CRISPR CCTCTCCGAGGGGAGGGACC TGG (reversed) Exonic
900092729 1:927461-927483 CCTCACGCAGGGCAGGGACCTGG - Intronic
900131774 1:1090269-1090291 TGTCACCGAGGGGAGGGCCCTGG + Intronic
900297143 1:1957518-1957540 CTTCTCCCAGGGGAGCGTCCAGG - Intronic
900500934 1:3004236-3004258 CCTCTGCCAGCTGAGGGACCAGG - Intergenic
900696936 1:4018081-4018103 CCTCTCAGAGGGGAGAGCCATGG + Intergenic
901018939 1:6246208-6246230 CCTCTCCCACGAGAGGCACCGGG - Intergenic
901494412 1:9613097-9613119 CCCCTCGGAGGGGAGCAACCCGG + Exonic
902438110 1:16411016-16411038 TCCCTCTGAGGGGAGGGAACAGG - Intronic
902583350 1:17423197-17423219 CATCTCAGAGGGTAGGGACGGGG - Intronic
903184282 1:21620482-21620504 CCTCTCCAAGGGGAGTGAGCTGG + Intronic
904285732 1:29452263-29452285 GCTCCCCGAGGGGAGGGATGGGG + Intergenic
904419689 1:30383762-30383784 GCTCCCCGAGGGGAGGGATGGGG - Intergenic
904869055 1:33605103-33605125 CCTCTCCAGGGAGAGGGTCCTGG - Intronic
905630847 1:39517770-39517792 CATCTCCAAGGGAAGGGACCGGG + Intronic
905666912 1:39768402-39768424 CATCTCCAAGGGAAGGGACCGGG - Intronic
906033199 1:42736083-42736105 CCTCTGCCAGGGCAGGGACTGGG - Intronic
906640212 1:47437217-47437239 CCTCTCCGCGCGGAGAGGCCGGG - Exonic
907114761 1:51959022-51959044 GCTCCCTGAGGGCAGGGACCGGG - Intronic
912931520 1:113967897-113967919 CTTCTTCGAAGGGAGGGAACTGG - Exonic
914256236 1:145962574-145962596 GCGCTCCGGGAGGAGGGACCAGG - Exonic
914915818 1:151818641-151818663 CCACTCAGAGGGGAGGCAGCAGG - Intronic
915255747 1:154627469-154627491 ACTCTCCGAGGCGGGGGAGCCGG + Intronic
917972816 1:180219579-180219601 CCTCCCTGTGGGGAGGAACCTGG - Intergenic
919678319 1:200409361-200409383 CCTCTGCGAGGGGAAGGCCGCGG + Exonic
919755642 1:201064442-201064464 CCTCGCTGAGGGCAGGGAACAGG - Intronic
922482480 1:225948797-225948819 CATCTCCGAGGGAAGGGAGGTGG - Intergenic
922684818 1:227630993-227631015 CCTCTTCAAGGGGAGAAACCTGG - Intronic
922781655 1:228257243-228257265 ACTTTCCCAGGGGAGGCACCTGG - Intronic
922917610 1:229271256-229271278 CGTCTCGGTGGGGAAGGACCTGG - Exonic
924729097 1:246695944-246695966 CTTCTACCAGGCGAGGGACCTGG + Intergenic
1062910471 10:1208788-1208810 CCTCCCAGAGGGCAGGAACCAGG - Intronic
1065140638 10:22715023-22715045 CAGCACCGAGGGGAAGGACCCGG + Intergenic
1065401012 10:25301389-25301411 TATCTCTGAGGGTAGGGACCGGG - Intronic
1065971118 10:30806689-30806711 CCCCACCGTGGGGAGGGAGCAGG + Intergenic
1068262975 10:54607491-54607513 GGTCTCTGAGGGCAGGGACCTGG - Intronic
1069592139 10:69648763-69648785 CCTCTCCTAGGTGAGGGAAATGG - Intergenic
1069631124 10:69897554-69897576 CCTCTCAGTGGAGAGGGGCCCGG - Intronic
1069641735 10:69960802-69960824 CCCCTCCCAGGCGAGGGCCCAGG + Intronic
1070498512 10:77047922-77047944 CCCATCTGAGGTGAGGGACCAGG + Intronic
1070752688 10:78973532-78973554 CCCCTCCGCGGGGCGGGACTGGG - Intergenic
1073577870 10:104640686-104640708 CCTCCCCGCGCGGAGGCACCTGG + Intergenic
1075277091 10:121103984-121104006 CCTCTGTGAGGGCAGAGACCAGG - Intergenic
1075504979 10:123013636-123013658 CCTCTCCGCGGGGCAGGCCCCGG - Intronic
1076699584 10:132264543-132264565 CCTCAGGGAGAGGAGGGACCCGG + Intronic
1077303935 11:1859523-1859545 CTTTTCTGAGGGGAGGTACCTGG - Intronic
1077445170 11:2587455-2587477 CCACCCAGAGGGGAGGGGCCAGG + Intronic
1077635829 11:3840901-3840923 CCTCCCCGAGGCGGGGGAGCTGG + Exonic
1078594598 11:12675006-12675028 CCCCTCCGAGGTGAGCGGCCGGG + Intronic
1083757896 11:64801329-64801351 CCCCTCTCAGGAGAGGGACCTGG - Intronic
1084686038 11:70695984-70696006 CCTCTCTGAGGTGAGGTCCCAGG + Intronic
1085485628 11:76860843-76860865 CCTCCCCGAGGGGCGGGGCCTGG - Intergenic
1086360555 11:86054595-86054617 CCTCACAGAGGGGAGGTAACAGG - Intronic
1086938575 11:92770676-92770698 CATATGCTAGGGGAGGGACCTGG + Intronic
1087225316 11:95592429-95592451 CCTCTCCTAAGGGAAGGACTTGG - Intergenic
1089296020 11:117468729-117468751 CCTCTGGGAGGGAAGGAACCAGG + Intronic
1089397048 11:118143109-118143131 CCCCACTGAGGGGAGGGGCCTGG - Intronic
1089654191 11:119935144-119935166 CCTATCCTCAGGGAGGGACCTGG + Intergenic
1090382477 11:126336978-126337000 CCTCTCAGCTGGGATGGACCGGG - Intronic
1091218418 11:133917453-133917475 CCTCCCCGAGGGGAGGGGGCAGG - Intronic
1091571642 12:1691532-1691554 CCTCTCCGCGGGCAGGGAGCTGG - Intronic
1091647857 12:2287245-2287267 CCTTCCCAAGGGGAGGGATCGGG + Intronic
1096578437 12:52569367-52569389 CCACTCCGAGAGCAGGAACCTGG + Intronic
1100407329 12:94283109-94283131 GCTCTGTGAGGGCAGGGACCTGG - Intronic
1102162700 12:110782412-110782434 CCTCCCAAAGGTGAGGGACCAGG + Intergenic
1102457560 12:113080127-113080149 CCTCTCGGAGGAGAGGGTCATGG + Intronic
1104842212 12:131830564-131830586 CTTCCCCGCGGGGAGGGACGAGG + Intronic
1105280696 13:18960990-18961012 CCCCTCAGAGAGGAGGGCCCAGG + Intergenic
1105931385 13:25056094-25056116 GCTCCCCGAGGGCAGGGACCTGG - Intergenic
1106312008 13:28562913-28562935 CCCCTCCCAGGGGAAGGGCCTGG - Intergenic
1107332797 13:39319730-39319752 GCTCTCCCAGGGGAAGGAGCAGG + Intergenic
1108590073 13:51905511-51905533 CCTTTGTGAAGGGAGGGACCTGG - Intergenic
1112247132 13:97745528-97745550 CCTCTTTGAGGGGTGGGAACTGG - Intergenic
1112723696 13:102277523-102277545 CCTTTCCCAGGGGAGGGACCTGG + Intronic
1114646591 14:24259579-24259601 CCTTTACGAGGGCAGGGACAGGG + Intronic
1116733138 14:48651349-48651371 CCTCTCGGCGGGGAGGGTCGGGG + Intergenic
1118729543 14:68656710-68656732 CCTCTCAGGGGTGGGGGACCTGG - Intronic
1118755910 14:68843583-68843605 GCTCTGTGAGGGCAGGGACCAGG + Intergenic
1119004244 14:70908699-70908721 CCTCCCTGGGGGGAGGGAGCGGG + Intronic
1122690753 14:103531196-103531218 CCTCCTCGAGGGCAGGAACCTGG - Intronic
1124342982 15:28901880-28901902 GCTCCCCGAGGGCAGGGTCCAGG - Intronic
1126436810 15:48645472-48645494 CCGCGCCGAGGGCAGGGACAGGG - Intronic
1127884749 15:63189486-63189508 CTTCTCCGAGAGGAGGGGCGGGG + Exonic
1128740367 15:70079444-70079466 CCTTTCCCAGGGGAGGGGCTGGG - Intronic
1128782140 15:70367404-70367426 CTTCTCCCAGTGGAGAGACCGGG + Intergenic
1129937943 15:79466218-79466240 CCTCGGCGAGGGAAGGGACCAGG + Intronic
1131032253 15:89196056-89196078 CCTCTCCGAGGGGAGGGACCTGG - Exonic
1133277613 16:4648217-4648239 AGTCTCCGAGGGGAGGACCCGGG - Intronic
1134121239 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG + Intronic
1137573190 16:49579796-49579818 CCTCTCCCATGGGAGGGCACAGG + Intronic
1138635608 16:58335657-58335679 AGTCTCCGAGGTGAGGGACGTGG + Intronic
1140474140 16:75230165-75230187 CCTCTCCCGGGGACGGGACCAGG + Intronic
1142108674 16:88319547-88319569 CCTCTCAGAGGGGAAGCAGCGGG + Intergenic
1142377205 16:89712188-89712210 CCTCACCGAGAGGAGGTCCCTGG - Intronic
1142876033 17:2852825-2852847 CCGCGCCGATGGTAGGGACCAGG + Intronic
1142996204 17:3761950-3761972 CATCCCCAAGGGGAGGCACCGGG - Exonic
1143569165 17:7743955-7743977 CCTCCCTGAGGGCAGGGACTTGG - Intronic
1143954760 17:10659581-10659603 CCTCTTTGAAGGCAGGGACCAGG - Intergenic
1144823254 17:18090103-18090125 CATCTCTGAAGGGAGGGACTAGG - Intronic
1147240162 17:39085648-39085670 TCTCTCCTAGAAGAGGGACCAGG + Intronic
1148322402 17:46765501-46765523 CCTCACCGTGTGGAGGGCCCGGG + Intronic
1150003622 17:61456538-61456560 CCTCTCCGAGCGCTGGGCCCGGG - Exonic
1151946755 17:77323802-77323824 CATCTCCGAGGTGAGAGGCCTGG + Intronic
1152644646 17:81463157-81463179 CCCCACTGTGGGGAGGGACCTGG - Intronic
1155224573 18:23718288-23718310 CCTCACCCTGGGGAGGGAGCTGG - Intronic
1157321267 18:46636447-46636469 CCTCGTCGAGTGGAGGGAACTGG - Intronic
1157758867 18:50244236-50244258 CATGTGTGAGGGGAGGGACCTGG + Intronic
1160334905 18:78030215-78030237 CCTCCCAGAGGGGTGGGGCCAGG - Intergenic
1160529052 18:79552990-79553012 CTGCTCCGAGGGGTGTGACCAGG - Intergenic
1160679584 19:406602-406624 GCTCTCCGCGGGGTGGGAACTGG + Exonic
1160698173 19:494536-494558 CCCCTCAGAGGTGAGGGCCCAGG - Intronic
1160714164 19:568099-568121 CCTCTGGGAGGGGAGGCTCCGGG + Intergenic
1160872516 19:1283644-1283666 CCGCTCCTAGAGGAAGGACCTGG - Intergenic
1161283942 19:3459374-3459396 CATCACAGAGGGGAGGGGCCAGG - Intronic
1161498095 19:4598260-4598282 GCTCTTCGAGGGGCGGGAACAGG + Intergenic
1162396557 19:10420772-10420794 CCTTTCCGAGGGGACGGTCGGGG - Exonic
1163015243 19:14450724-14450746 CCTCTCCAAGGGGCGGGGCCTGG + Intronic
1163099019 19:15082356-15082378 CATCACCAAGGGGAGGGTCCCGG - Intergenic
1163795432 19:19335179-19335201 TCTCTCAGAGGGGAGGGAGGGGG - Intronic
1164040637 19:21489718-21489740 CTTCTCTGAGGGCAGGGACCAGG - Exonic
1164206931 19:23066994-23067016 CTTCTCTGAGGGCAGAGACCAGG + Intergenic
1164233530 19:23312178-23312200 CGTCTCTGAGGGCAGTGACCAGG - Intronic
1164325951 19:24191913-24191935 CTTCTCTGAGGGCAGTGACCAGG + Intergenic
1165339619 19:35201716-35201738 CCTGTGCCAGGGCAGGGACCAGG + Intergenic
1165871459 19:38975934-38975956 GCTCTCCCAGGGGTGGGCCCCGG - Intergenic
1166103222 19:40583513-40583535 CCTCTCCCAGGGGAGGGTCTCGG - Intronic
1166723370 19:45010412-45010434 GCTCTGCGAGGGCAGGGACTTGG - Intronic
1166754506 19:45182030-45182052 CCTCTGTGAGGGCAGGGACTGGG - Intronic
926689995 2:15726437-15726459 TCTTTGCGAGGGGAGGGAGCTGG + Intronic
927042150 2:19240512-19240534 ACTCTCTGAGGGCAGGGAGCAGG + Intergenic
927501061 2:23583554-23583576 CCTCTCAGAAGGGAAGGAGCTGG + Intronic
928109024 2:28491539-28491561 CCTCCATGAGGGAAGGGACCTGG - Intronic
935018776 2:99210969-99210991 CCACTGTTAGGGGAGGGACCTGG - Intronic
936657851 2:114508722-114508744 CCTCTCTGAGAGGAGGAAACAGG - Intronic
936867062 2:117086956-117086978 CCTCTCTGCGGGAAGGGACCAGG + Intergenic
948424274 2:237877634-237877656 CCTCTCCAAGGGCAGGCGCCTGG + Intronic
1168879472 20:1194399-1194421 CCTCTCCCAGGGGAGTGGCTTGG - Intergenic
1168903070 20:1382122-1382144 CCTCTCTTTGGGGAGGGAACAGG + Intronic
1170562679 20:17570306-17570328 CCTCAGCCCGGGGAGGGACCCGG + Intronic
1170807662 20:19647139-19647161 CCTCTGAGAGGAGAGGGAGCTGG - Intronic
1172276073 20:33680087-33680109 CCTCGCCAAGGGGAAGGAGCTGG - Intronic
1172306199 20:33882480-33882502 CTTTTCCGAGGGGAAGGAGCTGG + Intergenic
1172853703 20:37984769-37984791 GCTCCCCAAGGGCAGGGACCAGG + Intronic
1175773788 20:61640600-61640622 CCTCCTCGAGGGGTGTGACCCGG - Intronic
1175894098 20:62328481-62328503 CCTCTGAGAGGGGCGGGACTGGG - Intronic
1176015242 20:62927503-62927525 TTGCTCCGAGGGCAGGGACCTGG + Intronic
1176299239 21:5090795-5090817 GCTCTTCTAGGGCAGGGACCTGG + Intergenic
1178822490 21:35988450-35988472 CCCCTCCAAAGGGAGGAACCGGG + Intronic
1178974288 21:37208451-37208473 CCTCTCCTAGGGGAGGGGTCTGG + Intergenic
1179275215 21:39885699-39885721 CCTGTCCCAGGGGAGGGAGAGGG - Intronic
1179857787 21:44171152-44171174 GCTCTTCTAGGGCAGGGACCTGG - Intergenic
1180166404 21:46033085-46033107 CCTCTCCGAGGCCCGGGACTGGG - Intergenic
1180261193 21:46670318-46670340 CCTTCCCGAGGCCAGGGACCAGG + Intergenic
1181319229 22:21991772-21991794 GCTCTGTGAGGGGAGGGCCCAGG + Intergenic
1181966303 22:26658585-26658607 CCTCTTCCAGCGGAGGGCCCTGG + Intergenic
1182393656 22:30019996-30020018 CCTCTCCCCTGGGGGGGACCTGG - Exonic
1183465877 22:37980192-37980214 CCTCTCTGACGGCTGGGACCAGG + Intronic
949770018 3:7568825-7568847 CCTCCCCGTGGGGAGGGCTCGGG + Intronic
950424915 3:12919913-12919935 CCTCCCTGAGGGCAGGGAGCCGG + Intronic
951994798 3:28715054-28715076 CCCATCCGAGGGCAGGGTCCTGG + Intergenic
953392427 3:42541195-42541217 TCTCTCCCAGGGGAGGGGGCCGG + Intergenic
954422560 3:50426348-50426370 GCACTCCCAGGGGAGGCACCTGG + Intronic
960673627 3:120174922-120174944 CATCTGAGAGGGGAGGTACCAGG - Intronic
961165885 3:124763594-124763616 CTTCTCCGAGGGGCTGGAGCGGG - Exonic
961388324 3:126537022-126537044 GCTCCACTAGGGGAGGGACCTGG - Intronic
962351077 3:134656170-134656192 CCTCCCAGAGAGGAGGGGCCAGG + Intronic
963274062 3:143313276-143313298 ACTCACAGAGGGCAGGGACCCGG + Intronic
964970113 3:162549831-162549853 CATCTGTCAGGGGAGGGACCTGG - Intergenic
966904287 3:184510568-184510590 CCTCTCCGATGTGAGCCACCTGG - Intronic
981774144 4:148345851-148345873 CCTCTGAGAAGGGAGGGACTGGG - Intronic
982067982 4:151671570-151671592 CGTCGCAGAGGGGAGGGCCCTGG - Intronic
982866942 4:160525192-160525214 CCTCTTCAAGGGGAGGAACCTGG + Intergenic
985575111 5:670276-670298 CCTCTCTGAGGGGCGGGGGCCGG + Intronic
985887976 5:2694923-2694945 CATGTGTGAGGGGAGGGACCTGG + Intergenic
986911488 5:12564137-12564159 CCTCTCTTGTGGGAGGGACCTGG - Intergenic
987071215 5:14338650-14338672 CCCTTCTGAGGGCAGGGACCTGG + Intronic
992828153 5:80569742-80569764 CCTCGCCGAGCGGCGGGAACCGG - Intronic
997521877 5:134528186-134528208 CCACTCCGAGAGGAGGGGCCAGG - Intronic
1002159658 5:177307701-177307723 CCTCTGCGCGGGGAGGGGTCCGG + Exonic
1002600733 5:180352922-180352944 CCCCACGGAGGGGAGGGACCTGG - Intronic
1002950138 6:1801565-1801587 CCTCTCCGACGGGAGTGAGGTGG - Intronic
1002996679 6:2292527-2292549 CCTCTCAGGGGGCAGGGACTAGG + Intergenic
1003395480 6:5749157-5749179 CCTCCCCCAGGGAAGGGTCCAGG + Intronic
1003468827 6:6409478-6409500 CTTCTCGGAGAGAAGGGACCTGG + Intergenic
1006339532 6:33439069-33439091 GCCCTCTGAGGGCAGGGACCAGG - Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007166022 6:39829743-39829765 GCCCTCTGAGGGCAGGGACCAGG - Intronic
1007178664 6:39913112-39913134 CCTCTTGGAAGGGAGGGACGGGG + Intronic
1008030575 6:46688962-46688984 CCTCTCCGAGAGCATGGCCCAGG + Exonic
1011746734 6:90413692-90413714 CCTCTCCCAGGAGCGGGAACAGG - Intergenic
1011879124 6:92001531-92001553 CCAGTCCTTGGGGAGGGACCTGG + Intergenic
1014477590 6:121892378-121892400 CCACTCCCAGGGGAAGGCCCTGG - Intergenic
1015440701 6:133242470-133242492 CTTCTCCAAAGGAAGGGACCTGG + Intronic
1018854722 6:167667273-167667295 CCTCTCCGAGTGGAGCGGGCTGG - Intergenic
1019286959 7:228492-228514 CCTCTCACAGGGGAGGGACAGGG - Exonic
1019367917 7:644738-644760 CCTCCCAGAGGGCAGGCACCAGG + Intronic
1019494221 7:1330072-1330094 CCTCCCCCAGGGCAGGGGCCTGG - Intergenic
1020750307 7:12132561-12132583 CATCTGCCATGGGAGGGACCAGG - Intergenic
1021609837 7:22446231-22446253 GATCTCAGAGGGTAGGGACCGGG - Intronic
1023028589 7:36073966-36073988 CCACTGCTAGGGGTGGGACCTGG + Intergenic
1025785214 7:64637670-64637692 GCTCTCTGTGGGCAGGGACCAGG + Intergenic
1027432307 7:78127178-78127200 GCTCTCCGGGAGGAGGTACCTGG + Exonic
1029348042 7:99992944-99992966 CTTCTCCGAGGGGTGGGAAAAGG - Intergenic
1031899456 7:127392895-127392917 CGTGTCCGAGGGGAGGGAACCGG + Intronic
1032383411 7:131505867-131505889 CCTCTCCCAGAGGAAGGACCAGG - Exonic
1034357935 7:150468066-150468088 GCTCTCCAAGGGGAGCTACCAGG - Intronic
1034474375 7:151274225-151274247 CCTCACCGGTGGGAGGCACCTGG - Intronic
1034968675 7:155406299-155406321 CCTCTCTGAGGGCAGGGATCAGG + Intergenic
1035213904 7:157350242-157350264 TTGCTCAGAGGGGAGGGACCAGG + Intronic
1035225385 7:157429687-157429709 CCTCCCCGAGGGGAGGTCCTGGG - Intergenic
1035239270 7:157519465-157519487 CCCCACCCAGGGGAGGGCCCAGG - Intergenic
1038334186 8:26633248-26633270 ACTCTTGGAGGGGAGGGACTGGG - Intronic
1038497516 8:28014355-28014377 CATCTCCCAAGGGAGAGACCGGG + Intergenic
1047742575 8:127818446-127818468 TCTCTTCCAGGAGAGGGACCCGG + Intergenic
1048009261 8:130443290-130443312 CTTCTCCGCGGGGAGGGCGCCGG - Intronic
1049617503 8:143582078-143582100 CCTCTCTGTGGGGAGGGGCCTGG + Intronic
1049718235 8:144103765-144103787 GCGCTCGGAGGGGTGGGACCCGG - Exonic
1050851106 9:10287546-10287568 ACTCTCCCAGGGGAGAGGCCTGG - Intronic
1053272619 9:36760687-36760709 CTGCTCCAAGGGCAGGGACCAGG + Intergenic
1056658752 9:88529562-88529584 CCTCTCCCTGGGGAGGGAGTGGG - Intergenic
1060700506 9:125746651-125746673 CCGCGCCGGGGGGAGGGACGGGG - Intergenic
1060863387 9:126974861-126974883 CCTCTCCTGAGGGAGGGACAGGG + Intronic
1061108970 9:128553099-128553121 CCCGGCCGAGGGAAGGGACCGGG - Intronic
1061225579 9:129279135-129279157 CCTTGCCCAGGGGAGGGACCGGG - Intergenic
1061925983 9:133806275-133806297 CCTCAAGGAGGGGAGGGGCCCGG + Intronic
1061985424 9:134127581-134127603 CCTCCCTGAGGGCAGGTACCAGG + Intergenic
1062119986 9:134829291-134829313 TCTCTCCGAGGGCTGGGGCCAGG + Intronic
1062379482 9:136280395-136280417 AGTCTCCCAGGGGAGGGGCCGGG + Intergenic
1062547663 9:137070862-137070884 CCTCTCCAAGGGGCGGGGCCTGG + Intergenic
1062583168 9:137237149-137237171 CCTGTCCGTGGGGTGGGCCCAGG + Intergenic
1188133490 X:26466822-26466844 CCTGACCCAAGGGAGGGACCAGG + Intergenic
1192904815 X:75540174-75540196 CCTGTGTCAGGGGAGGGACCTGG - Intergenic
1198193942 X:134340896-134340918 ACTCTCCAAGGGGAGAGCCCTGG + Intergenic