ID: 1131034503

View in Genome Browser
Species Human (GRCh38)
Location 15:89212654-89212676
Sequence ACATGTATGAAAAGATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131034503 Original CRISPR ACATGTATGAAAAGATTGGA AGG Intronic
900941290 1:5800208-5800230 ACAAGTAGGAGAAGAATGGAAGG + Intergenic
901183437 1:7357222-7357244 ACATGAATGAAAAAATGGGAGGG - Intronic
905526560 1:38644518-38644540 ACATGTCTGCAAAGGTTGGTTGG - Intergenic
905771065 1:40638334-40638356 ACATGTATGAAGCCAGTGGAGGG - Intronic
905997540 1:42394359-42394381 ACATGCATGCACAGGTTGGAGGG + Intronic
907735888 1:57111531-57111553 ACATGAATGAAAAAATTAGAGGG - Intronic
908273196 1:62440779-62440801 AAATAAATGAAAATATTGGAAGG + Intronic
912148584 1:106826556-106826578 AAATGTATGTAAAGATTTAAAGG - Intergenic
912253195 1:108032053-108032075 ACATTTATGAAAAATTAGGAAGG - Intergenic
912911377 1:113762308-113762330 AAATGTATGAAGAAAATGGAAGG + Exonic
913377910 1:118174980-118175002 AGATATGTGAATAGATTGGAAGG + Intronic
914506870 1:148296979-148297001 ATATGTAAGAAGAGAGTGGAGGG - Intergenic
919051892 1:192521896-192521918 ACATTTATGCCAAAATTGGAAGG + Intergenic
922117990 1:222633210-222633232 ACATGAATGAATATATTAGAAGG - Exonic
924079449 1:240378644-240378666 ACATAAAGGAAAAGATTGAAAGG - Intronic
1067733402 10:48830290-48830312 ACATGTAAGGGAAGGTTGGAAGG + Intronic
1067798707 10:49341142-49341164 AGAAGTATGATAATATTGGAAGG + Intergenic
1068130304 10:52888393-52888415 ACATGTCTGAAGAGAGAGGAAGG - Intergenic
1069167039 10:65174032-65174054 ATGTGTATGAGAAAATTGGATGG - Intergenic
1069750621 10:70742937-70742959 ACATGTTTGTAAACATTAGAAGG - Intronic
1072469584 10:95699812-95699834 ACATTTTTGAAGAAATTGGAAGG + Intergenic
1073087098 10:100899395-100899417 ATATGTAAGAAAACATTGCATGG + Intergenic
1073996344 10:109319407-109319429 ATATGTATAAAAATATTTGAGGG + Intergenic
1074782462 10:116811828-116811850 ACATGTCTTAAAACATGGGAAGG + Intergenic
1075028642 10:119005527-119005549 AAATGTATGTAAAGATTTAATGG + Intergenic
1079445974 11:20556504-20556526 AGAGGTAGGAAAAGTTTGGAGGG - Intergenic
1080397059 11:31899750-31899772 ACATGTAAGCAAAGACTTGAAGG - Intronic
1080603310 11:33842326-33842348 ATCTGTATGACAATATTGGAGGG + Intergenic
1081626535 11:44659294-44659316 AGATGGATGAAGAGATTGAAAGG + Intergenic
1081914278 11:46720676-46720698 AGATGGATGAACAGATGGGAGGG - Intronic
1082837547 11:57662630-57662652 ACATTTATGAAAAGAAGGAATGG - Intergenic
1083894899 11:65614969-65614991 TCATATATGAAAAGAATGGCCGG - Intronic
1085092242 11:73726879-73726901 ACCTGAATAAAAAAATTGGAAGG + Intronic
1086240584 11:84685507-84685529 ATATGTATGAGAAGACTAGAAGG - Intronic
1086842585 11:91705904-91705926 ACCTATATGAAAAGACTGGTGGG - Intergenic
1087443477 11:98216535-98216557 ACATTGATGAAAAAATTTGAAGG - Intergenic
1090674458 11:128977039-128977061 AGATGGAGGCAAAGATTGGAGGG + Intronic
1091027386 11:132154022-132154044 TCATGTGTGCAAAGCTTGGAAGG + Intronic
1092120576 12:6040864-6040886 ACCTGTTTGAAAATATTGGCGGG - Intronic
1092134678 12:6138396-6138418 AAATGCATGAAAAGATGAGAGGG - Intergenic
1092969425 12:13677751-13677773 ACATGTATCAAAGGGTTGCAGGG - Intronic
1093821561 12:23625410-23625432 ATATGGATGAAAACATTTGAAGG + Intronic
1096299644 12:50415586-50415608 ACATATAACAAAAAATTGGAAGG - Intronic
1096880436 12:54664164-54664186 ACATGTATGAATAATTTTGAAGG + Intergenic
1096940844 12:55344230-55344252 AAATGTTTGAAAACATTAGAGGG + Intergenic
1097043584 12:56171150-56171172 ACATGAATGAGAACATTGGTAGG - Intronic
1097520264 12:60659442-60659464 ACAGTAATCAAAAGATTGGAAGG + Intergenic
1097927819 12:65149756-65149778 ATATGTATCAAAAATTTGGAGGG - Intergenic
1099079843 12:78163381-78163403 ACATGTATGAATAACTTAGAAGG + Intronic
1099767625 12:87008670-87008692 ACTTGTATGAAAAAAATGAACGG + Intergenic
1101894054 12:108741705-108741727 ACATTAATCAAAAGATTGCAGGG - Intergenic
1102341186 12:112122759-112122781 ACCTGTATGAGAGGATTAGATGG - Intergenic
1102401067 12:112630183-112630205 ATATTTATGAAATAATTGGATGG - Intronic
1102638522 12:114345850-114345872 ACATGTGTGATAAAATTGCATGG + Intergenic
1102762159 12:115397358-115397380 ACATGTCAGAAAAGATTCAAGGG - Intergenic
1103930586 12:124448742-124448764 AGATGTGTGAAAACACTGGAAGG + Intronic
1104481552 12:129112238-129112260 GAATGTATGAAAAGTTGGGAAGG + Intronic
1105359209 13:19691573-19691595 ACATGAATGAAAAGACTTGATGG + Intronic
1106210679 13:27641649-27641671 ACATGTTTGGAAATATTGTATGG + Intronic
1106586983 13:31066058-31066080 ATATGTAAGAAAAGAGTGGTGGG + Intergenic
1106666708 13:31858889-31858911 ACATGTTTGAAGAGCTTTGATGG - Intergenic
1107607516 13:42075251-42075273 AAATGTATTAACAAATTGGAAGG - Intronic
1107677713 13:42814108-42814130 ACTTGTTTGATAAGCTTGGAAGG - Intergenic
1107747790 13:43530332-43530354 ACAAGTAGGAAATAATTGGATGG - Intronic
1108167338 13:47707210-47707232 AAATGAATGAAATGATTGGGGGG + Intergenic
1109503690 13:63270970-63270992 ACAGGTAAGAAGAGCTTGGAGGG - Intergenic
1110070394 13:71168842-71168864 ACACTTTTGAAAAGATTTGAAGG + Intergenic
1110965454 13:81689390-81689412 ATATGTATTAAAAGACAGGAAGG - Intergenic
1111041468 13:82754949-82754971 GAATCTATGAAAATATTGGAGGG - Intergenic
1111136460 13:84051523-84051545 AGATGTATGAAAAGCTTTAAGGG + Intergenic
1111702909 13:91713283-91713305 ATATTTATGAAAAAATTGAAAGG + Intronic
1112524115 13:100127590-100127612 ACATATAATAAAAGATTTGAGGG + Intronic
1112851626 13:103712919-103712941 ATATTTATGAAAAAATAGGAAGG - Intergenic
1113301245 13:109021726-109021748 ACATGTCTAAAAAGATTGGGTGG + Intronic
1114528860 14:23382714-23382736 ACATGTTTGAGAAGAGTGCAAGG - Intronic
1114737334 14:25055778-25055800 GGATGTATGTAAAGGTTGGAAGG + Intergenic
1114764026 14:25350149-25350171 ATATGTATGAAGACTTTGGAAGG + Intergenic
1114903558 14:27097639-27097661 CCATGTATGAAAAGAAAGGGGGG - Intergenic
1115049715 14:29043056-29043078 ACATTTATCATCAGATTGGATGG + Intergenic
1115738630 14:36363139-36363161 ACATTTGTGAAAACATTGAAAGG - Intergenic
1116237904 14:42304775-42304797 ACCTAAGTGAAAAGATTGGAAGG - Intergenic
1117169019 14:53071404-53071426 ACATTTATGAAATGTATGGAAGG - Intronic
1118131428 14:62968458-62968480 ACATGTATGGAAAGCTGGTAGGG + Intronic
1118827334 14:69396082-69396104 ACATGTAGCAGAAAATTGGATGG - Intronic
1120289370 14:82547341-82547363 AGTTGTGGGAAAAGATTGGAAGG + Intergenic
1121465576 14:94113527-94113549 AGAAGTAGGAAAAGGTTGGAGGG + Intronic
1121503649 14:94459814-94459836 GTATGAATAAAAAGATTGGAAGG + Intergenic
1124133641 15:27013005-27013027 AACTGTAAGAATAGATTGGAAGG + Intronic
1124701380 15:31915906-31915928 AGATGTATCACTAGATTGGAGGG - Intergenic
1126469196 15:48988972-48988994 TGATGTATGTAAAGGTTGGAAGG + Exonic
1126606480 15:50482241-50482263 ACATTTATGAAATGATTGGTTGG + Intronic
1126964544 15:54036571-54036593 ACATACATGAAAAGAGGGGAGGG + Intronic
1127598009 15:60506457-60506479 ACACGTATGAACACACTGGAAGG + Intronic
1131034503 15:89212654-89212676 ACATGTATGAAAAGATTGGAAGG + Intronic
1131598409 15:93823097-93823119 GAATAAATGAAAAGATTGGAGGG - Intergenic
1132321015 15:100925494-100925516 CCAGGTATGAAGAGATGGGAAGG - Intronic
1135262353 16:20991607-20991629 ACACGTAAGAAAGGAATGGAGGG - Intronic
1137515499 16:49140086-49140108 ACATGGCAGAAAAGATGGGAGGG + Intergenic
1138978855 16:62242069-62242091 ATATGTATAAAAAGATGGGAAGG + Intergenic
1139158152 16:64469302-64469324 ACAATCATGAAAAGATTGAAAGG + Intergenic
1139280700 16:65767888-65767910 CAATGGAAGAAAAGATTGGAAGG - Intergenic
1139555365 16:67705624-67705646 ACATTTTTTAAAAGCTTGGATGG - Intronic
1141733544 16:85837981-85838003 ACATGGATGTAAACATGGGAAGG + Intergenic
1142659511 17:1418134-1418156 ACAGGTATGAAAAGATGAGAGGG - Intergenic
1144009698 17:11134954-11134976 CCATTTATGAAAAGTTGGGAAGG + Intergenic
1144547801 17:16214643-16214665 TCATGTATTAAAGGAATGGATGG - Intronic
1147638406 17:41978436-41978458 AAAGGTAGGAAAGGATTGGAGGG - Intronic
1148515263 17:48210996-48211018 TCATGTATAAAAAGACTGGGGGG + Intronic
1150930570 17:69580298-69580320 ACATTTAAGGAAAGATTGGCTGG + Intergenic
1151052690 17:70996339-70996361 ACATGCATGATAAAATTGCAAGG - Intergenic
1151079674 17:71314704-71314726 ACATGCATAAAAAGATAGGAAGG + Intergenic
1152046492 17:77939761-77939783 ACATCTAGAAAAAGACTGGAAGG - Intergenic
1152507176 17:80757634-80757656 ACAGGTATCAAAATATTGCATGG - Intronic
1152846961 17:82606799-82606821 ACTTGTAGGACAAGATTGAAGGG + Intronic
1153825856 18:8874301-8874323 ACATGGATTAAAAGACTCGAAGG - Intergenic
1154296283 18:13152423-13152445 AAATGGATAAAAATATTGGAAGG + Intergenic
1156190589 18:34715588-34715610 ACATGAAAGAAAATACTGGATGG + Intronic
1156218175 18:35023554-35023576 ACATATATTAATGGATTGGAAGG + Intronic
1156251248 18:35354394-35354416 CCATTTATGAAAAGAATAGAAGG - Intergenic
1156272659 18:35551296-35551318 ACATGTATGAAAGGAATGTGGGG + Intergenic
1156808925 18:41223934-41223956 ACAAGTATCATAAGACTGGATGG + Intergenic
1157367836 18:47082579-47082601 ACTTATTTGAAAAGATTGGCAGG - Intronic
1158778576 18:60617544-60617566 AAATGTATGAAATTATTGGCTGG + Intergenic
1159326478 18:66926201-66926223 ACAGCTATGAAAAACTTGGAGGG + Intergenic
1160063979 18:75557797-75557819 ACATTTGTTAAAAGTTTGGAAGG - Intergenic
1160216415 18:76936266-76936288 ACATGTTTCAAATGAATGGATGG + Intronic
1166500146 19:43334312-43334334 ACATACATGAAAAAATAGGATGG - Intergenic
1167565672 19:50255135-50255157 AGATGCATGAAAAGAGGGGAAGG - Intronic
927235533 2:20871072-20871094 ACACCTATGAAAAGATCTGAGGG + Intergenic
928871609 2:35987521-35987543 ACATGTATGAAGAAATTTGTAGG + Intergenic
928902981 2:36341384-36341406 ACATGTATCAAAATATTAGCTGG - Intergenic
929180457 2:39032650-39032672 AGATGTATGTAAAGAAAGGAAGG + Intronic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
929764591 2:44833489-44833511 ACATGCAAGACAAAATTGGAGGG + Intergenic
930745490 2:54878863-54878885 ACATTTGTGTAAAGATTGGTAGG + Intronic
931460459 2:62445733-62445755 ACATGAAAGAAGAGATTTGAAGG - Intergenic
932638197 2:73411848-73411870 ACAGGTAGGAGAAGACTGGAAGG - Intronic
932890667 2:75594366-75594388 ATATGTATGTAAAAATTCGAAGG + Intergenic
933766930 2:85715970-85715992 ATATGAATGAAAAGAATAGAAGG + Intergenic
933982050 2:87558600-87558622 ACATGTGGGATAAGATTGCATGG - Intergenic
936311787 2:111392212-111392234 ACATGTGGGATAAGATTGCATGG + Intergenic
937201062 2:120204804-120204826 AAATGTAAGAAAAAAATGGATGG - Intergenic
937480069 2:122249058-122249080 ACATCTCTGAAAAGAAAGGATGG - Intergenic
939453594 2:142403338-142403360 ACTTGTATAAAAAGATGGAATGG + Intergenic
939654680 2:144809037-144809059 ACGGGAATGAAATGATTGGATGG - Intergenic
940025792 2:149206002-149206024 ACTTGTCTGAAAAGAAAGGAGGG - Intronic
940091146 2:149919264-149919286 ACAAATATTAAAAGATCGGAAGG + Intergenic
941028044 2:160480009-160480031 ACATTTAAGAAAAGATTTGAAGG + Intronic
941384725 2:164840522-164840544 ACATGTTTGAGAAGAGAGGAAGG - Intronic
942283850 2:174394280-174394302 ACAAGAATGAAGAGATTAGATGG - Intronic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
942855015 2:180535045-180535067 ACATGTAGGAGAAGATGTGATGG + Intergenic
943375826 2:187075415-187075437 ACCTATATGAGAAGATGGGAAGG - Intergenic
943398039 2:187366654-187366676 TCACATGTGAAAAGATTGGAAGG + Intronic
943813030 2:192213185-192213207 ACATTTAGGAGAAAATTGGAGGG - Intergenic
945342282 2:208670970-208670992 TAATGGATGAAAAGATTGTAGGG - Intronic
947929987 2:233956567-233956589 ACATGTATGTATAGATTTGAAGG + Intronic
1171175769 20:23049990-23050012 ACATGTATGAAAAGAAAGAAAGG - Intergenic
1172936790 20:38626255-38626277 ACATGTGTGAGAGGATTGGTGGG - Intronic
1174094976 20:48081269-48081291 ACATGTCTGAGAATATAGGAAGG - Intergenic
1174280698 20:49437167-49437189 ACTTGAATGAAGAGATTGGGTGG + Intronic
1175495228 20:59409749-59409771 ACCTGTATGAAACGATAGGGAGG + Intergenic
1177325490 21:19583093-19583115 AGATGCATGAAAAAATTTGAAGG - Intergenic
1177525617 21:22286886-22286908 AGATGTTGGAAAAGTTTGGAGGG + Intergenic
1179099313 21:38342719-38342741 ACAAGTACAATAAGATTGGAAGG + Intergenic
1180636084 22:17264181-17264203 AAATGTATGATCAGAGTGGAAGG - Intergenic
1182619125 22:31608843-31608865 ACATCTTTGGAAAGATTGCAGGG + Intronic
1182786810 22:32914830-32914852 ACATGTTTGAAAACAAAGGAAGG + Intronic
1183351312 22:37336219-37336241 TGATGGATGAAAAGGTTGGAAGG + Intergenic
1184075136 22:42172163-42172185 ACATGTATGAGAACAGAGGAGGG - Intronic
949349522 3:3111341-3111363 ACATGTATAAACAGATGGGCAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951079397 3:18434022-18434044 ACATTTATGAAAAATTTTGATGG + Intronic
951460389 3:22945475-22945497 ACATGTAGCAAAAGATTTAAAGG + Intergenic
952855243 3:37764817-37764839 CCAGCTATGCAAAGATTGGAGGG - Intronic
953925543 3:46980607-46980629 GGATGTCTGAAAAGGTTGGAGGG + Intronic
955085636 3:55699899-55699921 TCCTGTATGGAAAGATGGGAAGG + Intronic
955397560 3:58567797-58567819 TCAAATATGAAAAGATTGGCTGG - Intronic
955666893 3:61358775-61358797 AAATCTAGGAACAGATTGGATGG - Intergenic
956322360 3:68011000-68011022 ACAGGTAAAAAAAGATTGAACGG + Intronic
956490086 3:69761748-69761770 AAAGGTAGGAAAAGATGGGATGG + Intronic
956836315 3:73099111-73099133 ACATGTGAGCAGAGATTGGAAGG + Intergenic
956981517 3:74644323-74644345 ACAAGTATGAAAAGATATGAAGG + Intergenic
958804634 3:98795078-98795100 ACATTTATTAAAATATAGGAAGG - Exonic
958995329 3:100898048-100898070 ACATGCATCAAATGGTTGGATGG + Intronic
959080464 3:101795567-101795589 ATATCTAGCAAAAGATTGGAGGG + Intronic
959180001 3:102966882-102966904 ACAAATATACAAAGATTGGAAGG - Intergenic
960026082 3:113011995-113012017 GAATGTAAGAAAACATTGGATGG - Intronic
960431770 3:117578010-117578032 CCATGACTGAAAAGATTAGATGG + Intergenic
961396614 3:126597401-126597423 AAATGTTTGAAAAAATTTGACGG + Intronic
961453490 3:127013178-127013200 AAATGTCTGGAAAGACTGGATGG - Intronic
962003966 3:131329680-131329702 ACATGAGGGAAAAGATTTGAAGG + Intronic
962668780 3:137684024-137684046 AAATGGATGGAAAGATTGGCTGG - Intergenic
963389618 3:144643138-144643160 ACATATATTAATAGATTGTAAGG + Intergenic
963971544 3:151435512-151435534 ACATGTCTCAAATGATTGGCAGG + Exonic
964019792 3:151995949-151995971 ACCTGTATGAGAAGAAAGGAAGG - Intergenic
964391930 3:156206722-156206744 GCGTTTATGAAAAGATGGGAAGG + Intronic
964788870 3:160431448-160431470 ACATTTAAGAAAAGATTACATGG + Intronic
966469861 3:180277038-180277060 AAATGTATGGAAATATTTGAGGG - Intergenic
967103917 3:186240151-186240173 AAATGTACGAAAAGATACGAAGG - Intronic
967304018 3:188043314-188043336 ACATGTGTCAAAAGTTTTGAAGG - Intergenic
969194525 4:5550206-5550228 ACATGTTGGAACAGTTTGGAGGG + Intronic
971549074 4:27926570-27926592 ACATGTAATAAAATATTGAAAGG - Intergenic
971892766 4:32545379-32545401 ACATGGCTGAGAAGAGTGGACGG - Intergenic
972722900 4:41718495-41718517 ACAGTTATCAATAGATTGGAGGG - Intergenic
972880280 4:43414606-43414628 GCATGTATCAAAATATTAGATGG + Intergenic
972944290 4:44235229-44235251 TCATGTATAAAAAGTTTTGAGGG - Intronic
973032130 4:45358590-45358612 AGAAGTTTGAAAAGTTTGGAGGG + Intergenic
973285077 4:48406089-48406111 ACTGGTATGACAAGATTGGCTGG + Intronic
973964063 4:56142571-56142593 ACATGAAAGAAAAGACTGGTAGG - Intergenic
974167751 4:58225601-58225623 ACATGTATGAATTATTTGGAGGG - Intergenic
974322414 4:60368673-60368695 AGATGTTGGAAAAGTTTGGAGGG + Intergenic
974384624 4:61189084-61189106 ACATTTGTGCAAAGAGTGGAAGG + Intergenic
975917855 4:79346499-79346521 AGATGTAGGAACAGTTTGGAGGG + Intergenic
976475946 4:85483100-85483122 CAATGCATGAAAAGACTGGAGGG + Intronic
976519329 4:86007898-86007920 ACATGCTTGAAAAGGGTGGAGGG - Intergenic
979006648 4:115307136-115307158 ACATGAATGAAACAATTTGAAGG - Intergenic
979289604 4:118965341-118965363 AGATGGATGAGAAGATTGGCAGG - Intronic
979514322 4:121589539-121589561 AAATGTACGCAAAGATTGGCAGG + Intergenic
980191845 4:129534400-129534422 ACATGTATTTAGAGATTGGAAGG - Intergenic
980280269 4:130709027-130709049 ACATATATGCCAAGATTGCAAGG - Intergenic
981746020 4:148053115-148053137 TCATTTTTAAAAAGATTGGAAGG + Intronic
982145703 4:152388206-152388228 ACATGTATGTAAACATTCAATGG + Intronic
983346254 4:166528665-166528687 ACATTTAAGCAAAGATTGGAAGG + Intergenic
983961946 4:173765182-173765204 ACATGTATGTAAAGTTTTAAAGG + Intergenic
984338630 4:178424830-178424852 ACATGAATGAAAAGGGTGGAAGG + Intergenic
984396690 4:179210936-179210958 AGATTTATGAAAAGATTGCAAGG + Intergenic
984520446 4:180795808-180795830 CCATGTATGAAGAGATTCAAGGG + Intergenic
985422575 4:189799515-189799537 ACATTTAAAAATAGATTGGATGG + Intergenic
987663867 5:20910096-20910118 AAATGTATGGAAATATTGTAAGG + Intergenic
988032531 5:25782335-25782357 ACATGTAAGAAGAGATGGAAGGG - Intergenic
988758820 5:34292094-34292116 AAATGTATGGAAATATTGTAAGG - Intergenic
989107910 5:37880659-37880681 AAATCTGTGAGAAGATTGGAAGG - Intergenic
989129620 5:38093750-38093772 ACATGTGTGCAATGATTGAAAGG - Intergenic
989237137 5:39161349-39161371 ACATTTAAGAAAATATAGGAGGG + Intronic
989393375 5:40925501-40925523 AGAGGTTTGAAAAGTTTGGAGGG - Intronic
990550169 5:56868031-56868053 ACAAGTATGTAAAAATCGGAAGG + Intronic
990625230 5:57603156-57603178 ACATGAAAGATCAGATTGGAAGG + Intergenic
990688822 5:58339036-58339058 ACATGTAGGAACAGATTTGTTGG - Intergenic
991189840 5:63857319-63857341 ACTTGTATGAAAAGTGTGGAGGG - Intergenic
993773029 5:91955203-91955225 ACATGAGTGAGAAAATTGGAGGG - Intergenic
996451278 5:123628106-123628128 ACATGTATTAACAGATTTAAAGG + Intergenic
996708630 5:126522335-126522357 TCAGGTATTATAAGATTGGAGGG - Intergenic
997904474 5:137802046-137802068 ACATGTAATAAAAGAATGGTTGG + Intergenic
998821998 5:146065651-146065673 ACATGGGTGAAGAGACTGGAGGG - Intronic
1001481950 5:172094687-172094709 ACTTGTCTTAAAAAATTGGAAGG - Intronic
1001906109 5:175474771-175474793 AAAGGAATGAAAATATTGGAAGG + Intergenic
1003470328 6:6423618-6423640 ACATGTATCAGAAGATTTAAAGG + Intergenic
1003922305 6:10844580-10844602 ACATGTATCAAAATATTATATGG - Intronic
1004110307 6:12711461-12711483 ACATGTATGCAAGGAGTTGAGGG - Intergenic
1004803361 6:19175262-19175284 ACATGTGGGAAGAGATGGGATGG + Intergenic
1005574995 6:27182339-27182361 ACATTAATGAAAAGATGGAATGG - Intergenic
1006835474 6:36996348-36996370 ACATTTAAGCAAAGATTTGAAGG + Intergenic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1007291811 6:40793209-40793231 ATCTCTAGGAAAAGATTGGATGG + Intergenic
1008676905 6:53828572-53828594 ACATACATGAAAGGAATGGAAGG - Intronic
1008701934 6:54111173-54111195 ACATGCATGAAAAGAAAAGAGGG + Intronic
1009417322 6:63430102-63430124 AGATGTGAAAAAAGATTGGAGGG + Intergenic
1009897469 6:69770886-69770908 ACATGTAAGCAAAGATTTAAAGG + Intronic
1010644900 6:78375027-78375049 ACAGGTATGTAAAGATTAAAAGG + Intergenic
1011592639 6:88985328-88985350 AGATGTTTGAATAGATTGAATGG - Intergenic
1014600990 6:123411914-123411936 ACATTTAAGAAAACATGGGAAGG + Intronic
1014661463 6:124178077-124178099 AAATGGATGAACAGATTGGCCGG - Intronic
1015879893 6:137861477-137861499 AGATGAATGAAAGGATTGGGAGG - Intergenic
1016129230 6:140445070-140445092 AAATGCATGAAAATATGGGAAGG - Intergenic
1016907089 6:149161750-149161772 ACATGGAGGAAGAGATAGGAAGG - Intergenic
1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG + Intergenic
1017345572 6:153376577-153376599 ACATGTATCAAAACATCAGATGG + Intergenic
1021105596 7:16636003-16636025 ACTTGTATTAAGAGATTTGAAGG + Intronic
1021932568 7:25596232-25596254 ACATGTAAGGGAAAATTGGAGGG + Intergenic
1022235912 7:28460073-28460095 AGATGTATGAAGACATTCGATGG + Intronic
1023501601 7:40856236-40856258 ATATGAATGAAAAGAATGGAAGG - Intronic
1024876820 7:54035512-54035534 ATATGTATGAAAATATTTTATGG + Intergenic
1025015724 7:55437594-55437616 ACATGAATTTACAGATTGGAAGG - Intronic
1025276487 7:57586120-57586142 ACAAATATGGAAAGATTGGCCGG + Intergenic
1028629259 7:92916037-92916059 AAATGTATGAAATGTTAGGAAGG + Intergenic
1028800766 7:94963576-94963598 ACATGGATGAAAACATTGTTAGG - Intronic
1028976519 7:96920929-96920951 TCAGGTATAAAAAGACTGGAAGG + Intergenic
1029032684 7:97485494-97485516 ACATGTATCACATGATTTGAGGG + Intergenic
1030186584 7:106768450-106768472 ACATGTATCAGAAGATAGCATGG - Intergenic
1031378707 7:121059559-121059581 AAATGTAAGAAAACACTGGAGGG - Intronic
1031483123 7:122301765-122301787 ACAATTATGAAAAATTTGGAGGG - Exonic
1031609035 7:123803384-123803406 ACAAGTATTAAAACATTGAAGGG - Intergenic
1033284708 7:140031019-140031041 AAATGGAAGAAAAGATAGGAGGG + Intronic
1033995321 7:147338818-147338840 AGATATATAAAAAGTTTGGAAGG + Intronic
1034336034 7:150324145-150324167 ACATCTGTGAGAAGATTGAAAGG - Intronic
1034605479 7:152309109-152309131 AAATATTTGAAAAGATTTGAAGG - Intronic
1035975482 8:4305855-4305877 ACACGTAAGCAAAGACTGGAAGG - Intronic
1038073405 8:24044062-24044084 AAATGCAGGAAAAGATTGAAGGG - Intergenic
1039267073 8:35837533-35837555 ATATATATGAAAACATTGGCTGG + Intergenic
1040663367 8:49600776-49600798 ACATGTAAGAAAAAAATGGGAGG + Intergenic
1042767271 8:72337218-72337240 ACATCTGAGGAAAGATTGGAGGG - Intergenic
1042770136 8:72371326-72371348 CCATGTATGTAATGATTTGATGG - Intergenic
1043017508 8:74958458-74958480 ACAGGTATTAAATGATGGGATGG - Intergenic
1043666256 8:82819002-82819024 ACATACATGAAAATATTTGAGGG - Intergenic
1043790418 8:84460119-84460141 ACAGGTATGAAAATCTTGAAAGG + Intronic
1045694854 8:104797418-104797440 ACATGTATCCTAAGATTGAAGGG - Intronic
1045761537 8:105613846-105613868 ACATTTATAAAAAGAATGGAAGG + Intronic
1045816881 8:106286839-106286861 ACATGAATAACAAGATTAGAGGG + Intronic
1046176013 8:110575824-110575846 TGATGTATGAACAGTTTGGAAGG - Intergenic
1046477310 8:114762821-114762843 ACATATTTGAAATGATTGGCAGG - Intergenic
1047039967 8:120982584-120982606 ACATGTATGAAATGAATGAAAGG - Intergenic
1047451266 8:124967029-124967051 AAATGTCTGAAAAGATGGGGTGG - Intergenic
1047631926 8:126716736-126716758 CCCTGTGTGAAAAGATAGGAAGG + Intergenic
1049700611 8:144009973-144009995 GCATGTGGGAACAGATTGGAGGG - Intronic
1050662348 9:7896273-7896295 AAATCTATGAAAAGATTTGATGG + Intergenic
1050731535 9:8714688-8714710 ACATTTAAGCAAAGATTTGAAGG - Intronic
1051974754 9:22935839-22935861 ACATGTATGGAGGGATTTGAAGG - Intergenic
1055222159 9:73948854-73948876 ACATGTTTTAAAATATTGCATGG + Intergenic
1055826146 9:80327335-80327357 CCATCTATGAAAAGATGTGAAGG + Intergenic
1059010356 9:110451288-110451310 ACATGTGTGAAAGGATTTGTAGG - Exonic
1060191034 9:121592869-121592891 ACATGTGAGAACAGACTGGAGGG + Intronic
1061787164 9:133036563-133036585 ACATTAATGAAAAGATGAGATGG + Intronic
1187264744 X:17720623-17720645 ATATTTATCAAAAGTTTGGATGG + Intronic
1187416839 X:19100737-19100759 ACATATGTGAAAAGAATGCATGG + Intronic
1189021331 X:37344753-37344775 TCATGTCTAAAAATATTGGAGGG - Intergenic
1189395210 X:40615450-40615472 ACATGTTAGAAAGGTTTGGAGGG + Intergenic
1189626146 X:42899032-42899054 ACGTCTATTAAAAGAGTGGATGG - Intergenic
1190735784 X:53255402-53255424 ACATATAGGAAAAAACTGGAAGG - Intronic
1193654371 X:84181875-84181897 AGATATATGAAAAGGGTGGAGGG - Intronic
1194042428 X:88958690-88958712 AGATGGATGAAAAGTTGGGATGG - Intergenic
1194298494 X:92156379-92156401 ACATTTAAGCAAAGATTTGAAGG - Intronic
1194922343 X:99781419-99781441 AGAGGTTTGAAAAGTTTGGAGGG - Intergenic
1195963851 X:110412831-110412853 ACATACAGGAAAAGACTGGAAGG + Intronic
1198169376 X:134090761-134090783 ACAAGTTTGAAAAGAAGGGAGGG + Intergenic
1199251716 X:145670710-145670732 ACATGGATGAAAACAATCGAAGG - Intergenic
1199639371 X:149845671-149845693 AAAAGTGTGAGAAGATTGGAAGG - Intergenic
1199800122 X:151242376-151242398 ACCTTTGTGAAAAGCTTGGAAGG - Intergenic
1200616104 Y:5381340-5381362 ACATTTAAGCAAAGATTTGAAGG - Intronic
1201352029 Y:13054498-13054520 TCATGAATGAAAGGGTTGGAAGG + Intergenic