ID: 1131036671

View in Genome Browser
Species Human (GRCh38)
Location 15:89226997-89227019
Sequence CCCCGCCTTCAGCCAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131036671_1131036677 21 Left 1131036671 15:89226997-89227019 CCTCTGCCTGGCTGAAGGCGGGG No data
Right 1131036677 15:89227041-89227063 TGTGCCCCCTTTCTGTACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131036671 Original CRISPR CCCCGCCTTCAGCCAGGCAG AGG (reversed) Intergenic
No off target data available for this crispr