ID: 1131046003

View in Genome Browser
Species Human (GRCh38)
Location 15:89316064-89316086
Sequence AAGTGGGTAAAGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131046003_1131046007 -7 Left 1131046003 15:89316064-89316086 CCATCCACTCTCTTTACCCACTT 0: 1
1: 0
2: 2
3: 40
4: 461
Right 1131046007 15:89316080-89316102 CCCACTTGGCAGCTGCACTCAGG 0: 1
1: 0
2: 1
3: 11
4: 191
1131046003_1131046009 22 Left 1131046003 15:89316064-89316086 CCATCCACTCTCTTTACCCACTT 0: 1
1: 0
2: 2
3: 40
4: 461
Right 1131046009 15:89316109-89316131 ATGTAGCATTTTGATGTCAATGG 0: 1
1: 0
2: 1
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131046003 Original CRISPR AAGTGGGTAAAGAGAGTGGA TGG (reversed) Intronic
900467967 1:2835037-2835059 TTGTGGGTACAGAGAGTGGGAGG + Intergenic
900818217 1:4866751-4866773 GAGTAGGTAAACAGAGTGGCCGG - Intergenic
901559346 1:10057926-10057948 ATGTAGGTAAAGAGAGGAGAAGG + Intronic
902360057 1:15937462-15937484 GAGTGGGAAGAGAGACTGGAAGG - Exonic
902702208 1:18180078-18180100 CAGTGGATAAAGGGAGTAGAGGG - Intronic
904790258 1:33014888-33014910 AAATGGGTGAACAGAATGGATGG - Intronic
904983413 1:34525265-34525287 AATTGGGTAATGAGAGGAGATGG - Intergenic
906288234 1:44602429-44602451 AAGTGAGTAGAGAGAGTAAAGGG + Intronic
906918766 1:50040822-50040844 AAGAGGGAAATGGGAGTGGAGGG + Intergenic
907055972 1:51368351-51368373 AAGTGGGAAAAAGGAGTGGGTGG + Intronic
907690332 1:56658285-56658307 AGGTGGTTAATGAGAATGGAAGG + Intronic
908000383 1:59673214-59673236 AAGGGGGTAAGGAGTGTTGAGGG + Intronic
908320192 1:62971275-62971297 AAGGGGGTGAGGAGAGTGCAAGG + Intergenic
908405225 1:63807791-63807813 TATTTGGTAAATAGAGTGGAGGG + Intronic
908432557 1:64073206-64073228 ATCTGGGCTAAGAGAGTGGAAGG + Intronic
909052910 1:70788940-70788962 AAATGGGAAAAGAAAGGGGAAGG + Intergenic
909059988 1:70868876-70868898 AAGTGGCTCAAGAGATTGGGTGG + Intronic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
910930236 1:92436428-92436450 GAGTAGGTAAACAGAGTGGTCGG - Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912777275 1:112513610-112513632 AAGTGGGTGAGGAGAAGGGAGGG - Intronic
913081214 1:115388993-115389015 AAGTAGGTAAACAAAGTGGCTGG - Intergenic
914445721 1:147749155-147749177 AGCTGGTTAAAGAGAGTGAAAGG - Intergenic
915142177 1:153774752-153774774 AACTGGGGAAGGAGAGAGGAAGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
915729494 1:158043229-158043251 AGATGGGAAAAGAGAGTGGATGG + Intronic
915783295 1:158578614-158578636 AATTGAGTAAAAAGTGTGGAAGG - Intergenic
915986709 1:160473296-160473318 CAGTGGGTCAAAAGAGTGGGAGG + Intergenic
916508359 1:165448493-165448515 AGAGGGGTCAAGAGAGTGGAGGG - Intergenic
916627603 1:166575210-166575232 AAGTGGGGCATGAAAGTGGATGG + Intergenic
916628085 1:166581366-166581388 ATGTGGGTGAAAAGAGTAGAAGG + Intergenic
916715148 1:167441548-167441570 AAGAGGGAACAGAGAGTGCAAGG - Intronic
917127088 1:171696581-171696603 CAGAGGGTAAAGGGATTGGATGG + Intergenic
917252150 1:173074413-173074435 AAGTAGGTAAACAAAGTGGCAGG + Intergenic
917960978 1:180144352-180144374 AACTGGGTAAATAGAGAAGAAGG + Intergenic
918522372 1:185428968-185428990 AATTGGGTAAATGGTGTGGAAGG + Intergenic
918590261 1:186233086-186233108 AGGTGGGTTAAGAGCATGGAGGG - Intergenic
918716685 1:187797740-187797762 AAGAGAAAAAAGAGAGTGGAAGG - Intergenic
918816466 1:189191751-189191773 AAATGGCTACAGAAAGTGGATGG - Intergenic
919093816 1:193005516-193005538 AAGTGGGTAAAGGGCATGAACGG + Intergenic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
921115219 1:212083589-212083611 AAGTGGCTTAGGAGAGTGAAAGG + Intronic
921826609 1:219679137-219679159 AAGGGGGTTAAGAGAGAGGGAGG + Intergenic
922663388 1:227449015-227449037 GAATGGGGAAAGATAGTGGAGGG + Intergenic
923225636 1:231936440-231936462 GTGTGGGTAGAGAGAGTGCAGGG - Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
1062922927 10:1293296-1293318 AAGGGGGAAGAGAGAGGGGAGGG + Intronic
1063003892 10:1950598-1950620 GAGTGGGTCAAGAGTTTGGAAGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064380238 10:14835367-14835389 AAGTGGGCATAGAGACAGGAAGG + Intronic
1065341291 10:24708613-24708635 ACATGGGTGTAGAGAGTGGAAGG - Intronic
1065661618 10:28009121-28009143 CAGTGGGGAAAGAGAATGGGAGG + Intergenic
1066584168 10:36913700-36913722 GAGTAGGTAAAGAAAGTGGCAGG - Intergenic
1068461173 10:57330961-57330983 AAATGGGAAATGAGTGTGGAAGG - Intergenic
1068838708 10:61586277-61586299 AAGGGGGAAACGTGAGTGGAGGG + Intergenic
1068904998 10:62312847-62312869 AAGTATGTAAAAAAAGTGGAGGG + Intergenic
1070050216 10:72881576-72881598 AAGAGGGTAAATAGGCTGGAAGG + Intronic
1070980448 10:80641464-80641486 GAGTAGGTAAACAAAGTGGATGG - Intronic
1071323750 10:84491402-84491424 GAGTAGGTAAAGAAAGTGGCCGG - Intronic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1071737068 10:88312526-88312548 AGGTGGGTGAAGAGGATGGAAGG + Intronic
1076062049 10:127420521-127420543 CACTGTGTAAAGAGAGTTGAGGG + Intronic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1077482496 11:2822482-2822504 AAGTGCGTAAAGAGAGCTAAAGG + Intronic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1078390555 11:10932123-10932145 GTGTGGGAAGAGAGAGTGGAGGG + Intergenic
1078613972 11:12847572-12847594 AAGTGTGTGTAGAGAGTGGCAGG + Intronic
1079753857 11:24231003-24231025 AAGTGAATAGAGAGACTGGATGG + Intergenic
1079865925 11:25733667-25733689 AAGGGGGAAAAAAGAGTAGAAGG + Intergenic
1079881485 11:25932847-25932869 AAGGGGGTATAGAGAGGGAAGGG - Intergenic
1080782150 11:35439555-35439577 AAGTGGGGAAGGGGAATGGAAGG + Intronic
1084485348 11:69444843-69444865 ATGTGGCTGGAGAGAGTGGACGG + Intergenic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1086587697 11:88474539-88474561 AAGGGGGTAAAGGGAGGGAAGGG + Intergenic
1087360355 11:97150904-97150926 AAGTGTCTAATGAGACTGGAAGG - Intergenic
1088441050 11:109870649-109870671 AGGAGGTAAAAGAGAGTGGAAGG - Intergenic
1089091449 11:115880795-115880817 GAGTAGGTAAACAGAGTGGCTGG - Intergenic
1089539291 11:119180344-119180366 AAGTGGGAAAAGAAAGTGCCAGG + Intronic
1091316314 11:134616384-134616406 AGGAGGGGAGAGAGAGTGGAAGG - Intergenic
1091511260 12:1129018-1129040 GAGTGGATAAAGAGAATGGGAGG + Intronic
1092376215 12:7957470-7957492 AAGGGGGTTAAGGGAGTAGATGG - Intergenic
1092464084 12:8712604-8712626 AGGTGGGTCAAGAGAGAGGTAGG + Intronic
1093514841 12:19973476-19973498 CAGGAAGTAAAGAGAGTGGAGGG - Intergenic
1097260154 12:57714951-57714973 AAGAGGGTAAAGAGATTGATTGG - Intronic
1098109847 12:67110807-67110829 ATGTGGCTAAAGGGAGTTGAGGG + Intergenic
1098696949 12:73571844-73571866 AAGTGGTTAAAGAGAATAAAAGG + Intergenic
1099771813 12:87069297-87069319 AAGTAGATAAAGACATTGGATGG - Intergenic
1100127643 12:91448542-91448564 AAATTGGTATAGAGATTGGAAGG + Intergenic
1100517346 12:95341180-95341202 GAGTGTGTGAAGAGAGTGAATGG - Intergenic
1101361831 12:104034614-104034636 GAGTGGGTAAACAAAGTGGGTGG + Intronic
1102669129 12:114602227-114602249 AAGTGGGGAGAGAGAAAGGAGGG - Intergenic
1102687371 12:114735380-114735402 AGAAGGGGAAAGAGAGTGGATGG + Intergenic
1102877977 12:116462446-116462468 AAGTGGGGAGAGAGAGAGGGAGG + Intergenic
1102927751 12:116839575-116839597 GAGTGGGTAAATAGGATGGATGG + Intronic
1102986959 12:117286037-117286059 AAGAGGGGAAGGGGAGTGGATGG - Intronic
1104581443 12:130014034-130014056 AAGAGGGCAAGGAGAGTGGCGGG + Intergenic
1104710835 12:130984775-130984797 AAGAAGGAAAAGAGAGAGGAGGG - Intronic
1105289610 13:19043108-19043130 AAATGGGTATACAGTGTGGATGG - Intergenic
1105569057 13:21582733-21582755 AATTGGCTAAAGAGAGTGACGGG - Intronic
1106061056 13:26292470-26292492 AAGAAGGGAGAGAGAGTGGAGGG + Intronic
1106961151 13:34999380-34999402 AAGGGGGTAAAGAGAGTATTGGG - Intronic
1107350370 13:39507969-39507991 AAGAGGGAAAAGAAAGGGGAGGG - Intronic
1108026905 13:46187511-46187533 AAGTAGACAAAGAAAGTGGATGG - Intronic
1108040848 13:46338347-46338369 AAGTGGGAAGAGAGAGGGGCAGG - Intergenic
1108748954 13:53426602-53426624 TAGAGGGGAAAGAGAGAGGAGGG - Intergenic
1109367319 13:61372403-61372425 AAAGGGGTACAGAGAGGGGAGGG + Intergenic
1110676861 13:78258444-78258466 AAGTCTGTGAAGAGAGTTGAAGG + Intergenic
1110946470 13:81426992-81427014 AAGAAGGTGAAGAGAATGGAGGG - Intergenic
1111038089 13:82705361-82705383 AAGAGGGTAAGAAGAGTGAAGGG + Intergenic
1111477484 13:88771497-88771519 AAGGGGGAAAGGAGAGTGAAGGG - Intergenic
1112782156 13:102912903-102912925 AAGGAGGTAGAGAGGGTGGAAGG - Intergenic
1113084104 13:106549680-106549702 AAGGGGGTAAAGGGAGTAGGTGG - Intronic
1117408798 14:55430749-55430771 AAGTGGGTGAAGAGAGCCAAGGG - Intronic
1117665309 14:58050403-58050425 GAATGGGTAGAGAGAGAGGAAGG - Intronic
1118857727 14:69637153-69637175 AGGTGGGTACAGGGAGTGGTGGG - Intronic
1119739339 14:77004080-77004102 GAGTGGGGTAAGACAGTGGAAGG + Intergenic
1120008240 14:79384253-79384275 AGGTGGGGGAAGAGAGGGGAAGG + Intronic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1121524940 14:94613218-94613240 AAAGGGGAAGAGAGAGTGGAAGG - Intronic
1122329870 14:100904819-100904841 AAGTGGGGAACGAGAGATGAGGG + Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124695998 15:31864727-31864749 GTGTGGGTAAAAAGAATGGAGGG - Intronic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1126368423 15:47920293-47920315 AAGGTGGACAAGAGAGTGGAAGG - Intergenic
1127673309 15:61216521-61216543 AAGTGAGTAAAGGGAAGGGAGGG + Intronic
1127957599 15:63866439-63866461 AAGTGGGAAACGGGAGTGGTAGG - Intergenic
1128280573 15:66390796-66390818 ATGTGGTTAAAGAGATTGGTGGG - Intronic
1128408576 15:67369464-67369486 AAGGAGGGAAAGAGAGAGGAAGG + Intronic
1128980424 15:72181353-72181375 AAGTGGGGCAGGGGAGTGGAGGG + Intronic
1129019342 15:72502126-72502148 AAGTGGGGAGAGATAATGGAAGG - Intronic
1129218944 15:74120119-74120141 AAGTTGGTTATGAGAGAGGATGG - Intronic
1129404802 15:75309068-75309090 AAGTTGGTTATGAGAGAGGATGG + Intergenic
1129478383 15:75803318-75803340 AAGTTGGTTATGAGAGAGGATGG + Intergenic
1129836471 15:78710636-78710658 AAGTTGGTTATGAGAGAGGATGG + Intronic
1129942490 15:79510398-79510420 AAGTGGTTCATGAGAGTGGAAGG - Intergenic
1130330700 15:82920156-82920178 AAGTGGGCAAAAAGAATTGATGG - Intronic
1130622052 15:85473711-85473733 AAGAGGGTCATGAGAGGGGAGGG + Intronic
1130703661 15:86211509-86211531 GAGTGGGTAAACAAAGTGGCTGG - Intronic
1130839462 15:87684205-87684227 AAGTCAGCAAGGAGAGTGGAGGG + Intergenic
1130899274 15:88194827-88194849 AAGTGAATAAAGAGAGAGGGAGG - Intronic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1131248016 15:90812735-90812757 GAGTGGGGAAAGAGAAAGGAAGG + Intronic
1133185864 16:4098032-4098054 AAGCTGGAAAAGAGAGTGGCTGG + Intronic
1133185962 16:4098722-4098744 AAGATGGAAAAGAGAGTGGCCGG + Intronic
1134039055 16:11053907-11053929 AAGTGGGAAGAGACAGTGGCAGG + Intronic
1134385475 16:13768128-13768150 TGGTGGATAAAGGGAGTGGAGGG - Intergenic
1135546248 16:23368852-23368874 ACGTGGATATAGAGTGTGGAAGG + Intronic
1135765362 16:25173008-25173030 AGGCGGGTAAGGAGATTGGAAGG + Intronic
1135943170 16:26840548-26840570 AAGGAGGGAAAGAGAGTGAAGGG + Intergenic
1136714650 16:32268816-32268838 AAGTGAGTAAAGGGACTGGGAGG + Intergenic
1136753257 16:32660931-32660953 AAGTGAGTAAAGGGACTGGGAGG - Intergenic
1136814856 16:33209434-33209456 AAGTGAGTAAAGGGACTGGGAGG + Intronic
1136821332 16:33319514-33319536 AAGTGAGTAAAGGGACTGGGAGG + Intergenic
1136827895 16:33376053-33376075 AAGTGAGTAAAGGGACTGGGAGG + Intergenic
1136832961 16:33474824-33474846 AAGTGAGTAAAGGGACTGGGAGG + Intergenic
1137284619 16:47004876-47004898 ATGTGGTAAAAGAGATTGGAAGG + Intergenic
1137323141 16:47407000-47407022 AAGCGGGAAAATAGAATGGAAGG + Intronic
1137521616 16:49199929-49199951 ATGTGGGAAAAGAGAGTCCAGGG - Intergenic
1137904695 16:52309410-52309432 AAGGGGGAAAAGAGAGAGGTTGG - Intergenic
1138081480 16:54094997-54095019 AAGGGGGCAAAGAGAGGGGATGG - Intronic
1139552931 16:67685717-67685739 GAGTTGGTAAAGAGAGAGGCTGG - Exonic
1139562944 16:67755282-67755304 AGGTGGGTCTAGAGAGAGGATGG + Intronic
1140464479 16:75168975-75168997 AAGTGGGCAGAGAGGGTGAAAGG - Intronic
1140834706 16:78782321-78782343 AAGTAGGAAAACAGAGAGGATGG - Intronic
1142021112 16:87783293-87783315 ATGGGGGTAAAGGGAGGGGAAGG - Intergenic
1202993433 16_KI270728v1_random:32408-32430 AAGTGAGTAAAGGGACTGGGAGG + Intergenic
1203055401 16_KI270728v1_random:920953-920975 AAGTGAGTAAAGGGACTGGGAGG - Intergenic
1142738808 17:1918334-1918356 AAGGGGGTAGAGAGAGAAGAAGG - Intergenic
1143074744 17:4331730-4331752 AACTGAGTAAGCAGAGTGGAGGG + Intronic
1144018971 17:11223053-11223075 GACAGGGGAAAGAGAGTGGAAGG + Intergenic
1144887930 17:18476696-18476718 AAGTGGGTCCAGAGAGAGAAAGG - Intergenic
1145144278 17:20467605-20467627 AAGTGGGTCCAGAGAGAGAAAGG + Intergenic
1145175729 17:20699005-20699027 AAGTGGGTCCAGAGAGAGAAAGG + Intergenic
1145791585 17:27631107-27631129 AAGTGGGTCCAGAGAGAGAAAGG - Exonic
1146630409 17:34465455-34465477 AAGAGGGTAGAGAGCGTGGGAGG - Intergenic
1147817600 17:43221323-43221345 GAGGGTGGAAAGAGAGTGGAAGG - Intergenic
1148721949 17:49760021-49760043 AAATGGGTTAAGAGAGGAGAGGG + Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1149418237 17:56482885-56482907 AAGTGGGGAGAGAGAGGGAAGGG - Intronic
1150098438 17:62399764-62399786 AAGTGGGGACAGGGAGTGGTAGG - Intronic
1150186293 17:63185097-63185119 AGGTGGGTAAAGTAAGAGGATGG - Intronic
1151352125 17:73537927-73537949 AAGAGGATGAAGAGGGTGGAGGG + Intronic
1151471737 17:74322610-74322632 AAGTGGTGAAGGTGAGTGGAAGG + Intergenic
1154465786 18:14641971-14641993 AAGAGGGTGCAGAGAGTGGGGGG - Intergenic
1156056351 18:33009215-33009237 AAGTGGTCAAAGACAGAGGAAGG - Intronic
1157174735 18:45441112-45441134 AAGTGGAAAAAGAGAGGGCATGG - Intronic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157583185 18:48785161-48785183 AGGAGGGAAAAGAGAGAGGAAGG - Intronic
1157774658 18:50383098-50383120 AAGGGGGAAGAGAGAGAGGATGG - Intronic
1160128112 18:76197955-76197977 AAGTAGGTAAAGAGAGTCTCTGG - Intergenic
1161635007 19:5382706-5382728 CAGTGAGGAAAGAGAGAGGAAGG - Intergenic
1163005991 19:14397003-14397025 GAGTGGGTGCAGTGAGTGGAGGG + Intronic
1163061755 19:14766433-14766455 GAGTGGGTGCAGTGAGTGGAGGG - Intronic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164805027 19:31109777-31109799 AAGTGGTTAAAGTGATGGGAAGG + Intergenic
1164813640 19:31177482-31177504 AAGATGGAACAGAGAGTGGAGGG - Intergenic
1164934238 19:32198700-32198722 AAGGGGTTCAAGAGAGAGGACGG - Intergenic
1166643002 19:44510690-44510712 ATGGGGGGAAATAGAGTGGAAGG + Intronic
1167434253 19:49470014-49470036 AGGAGGTTTAAGAGAGTGGACGG - Intronic
1167444230 19:49528053-49528075 AACAGGGTAAAGGGAGTGGGTGG + Exonic
1168595045 19:57668634-57668656 AAGTGGGGAGGGAGAGTGCAGGG + Intergenic
924990005 2:306108-306130 AAGAGAGTAAACAGAGTGGAAGG - Intergenic
925758775 2:7163321-7163343 AAATTGGTGAAGAGAATGGAGGG + Intergenic
926668881 2:15555980-15556002 GAGTAGGAAGAGAGAGTGGAAGG - Intronic
926692533 2:15747564-15747586 AAGAGGGTAAAAAGAGTTGATGG - Intergenic
926992765 2:18697852-18697874 AAGTAGGTAAACAAAGTGGCCGG - Intergenic
927345492 2:22033880-22033902 ATGTGGGTAAAGAGAGGAGGGGG - Intergenic
927444711 2:23149004-23149026 AAGTGGATAAAGATATTAGAAGG + Intergenic
928632742 2:33210724-33210746 AGGAGGGTAAAGACAGGGGAAGG - Intronic
930512965 2:52369001-52369023 AATTGGGTAGAGAGATTTGAAGG - Intergenic
930837309 2:55808058-55808080 AAGTGGGTAGAGAGAGGCCAGGG - Intergenic
931251304 2:60532717-60532739 AAGTACTTAAAGGGAGTGGAGGG - Intronic
931267809 2:60675969-60675991 TTGTGGGTAGAGACAGTGGATGG + Intergenic
932125781 2:69144490-69144512 AAAGGGGGAGAGAGAGTGGATGG + Intronic
932346795 2:71001053-71001075 GAGTGGGTGAAGACAGTGGAGGG - Intergenic
932942768 2:76188507-76188529 AATTTGGAAAAGAGTGTGGAAGG + Intergenic
933253487 2:80054905-80054927 AATAGGGTGAAGAGAGTGGAGGG + Intronic
933762304 2:85680738-85680760 AACTGGGAAACCAGAGTGGAGGG + Intergenic
934298628 2:91763157-91763179 AAGTGGAGAAGGAGAGTGAAAGG - Intergenic
935162367 2:100540337-100540359 AAGTGGGTAGGGGGAGGGGAGGG + Intergenic
935365752 2:102289180-102289202 AAGTGGGTGATGAGAGTCGTGGG - Intergenic
936073795 2:109388842-109388864 AAGGGGGTATAGAGACGGGAGGG + Intronic
936459958 2:112706332-112706354 AAGGGGGTGGAGAGAGGGGAAGG - Intergenic
936605863 2:113952882-113952904 ATGTGGGTAAGGGGAGTAGACGG - Intronic
937696704 2:124816398-124816420 AGGTGGGAACAGAGACTGGATGG - Intronic
938069155 2:128299443-128299465 ATGTGGGGAAACTGAGTGGATGG + Intronic
939991382 2:148879097-148879119 AAGTGGGGAAAGACTGTGGCTGG - Intronic
940333710 2:152502873-152502895 AAGGGGGTAAGGAGAGGGTATGG + Intronic
940860431 2:158765233-158765255 AAAGGGCCAAAGAGAGTGGAAGG + Intergenic
941270144 2:163415517-163415539 AAGAGAGTAAAGAGAGTTTAAGG + Intergenic
941392598 2:164932940-164932962 AAATGGGTAAAGACAGAGGAAGG - Intronic
941733264 2:168943947-168943969 AAGTGGGTAGAGATGTTGGAAGG + Intronic
942456880 2:176144014-176144036 AAGTGATTAAAGAGAGAGTAAGG - Intergenic
942791899 2:179770065-179770087 AAGAGAGTAAAGAGGGTGGGAGG - Intronic
944154843 2:196598176-196598198 GAGAGGGGAAAGAGAGGGGAAGG + Intergenic
944330329 2:198458040-198458062 AGGAGGGAAAAGAGAGTAGAAGG - Intronic
944968288 2:204961337-204961359 AAGTGGTCAAATAGAGTGTATGG + Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
945997047 2:216446561-216446583 AAGTGGGAGAAGACAGTGGCAGG - Intronic
946556199 2:220860405-220860427 AAGTGGCAAAAGAAGGTGGAAGG + Intergenic
947422526 2:229953707-229953729 AAGAGGGGAAGGAGAGAGGAGGG + Intronic
948871924 2:240805043-240805065 AAGTGGGGAGGGAGAGGGGAGGG + Intronic
1169718677 20:8648182-8648204 AAGTGGGTGGAGGAAGTGGAGGG + Intronic
1170495193 20:16916854-16916876 AGGTGGGGAAAGAGAGTGTCAGG + Intergenic
1170672095 20:18443902-18443924 AGGTGGGCAAAGAGAAAGGATGG - Intronic
1171962114 20:31502372-31502394 AAGAGGGTACAGAAAGGGGAGGG + Intergenic
1172708663 20:36902674-36902696 AAGAAGGAAAAGAGAGTTGAGGG + Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173177811 20:40777707-40777729 AATTAGGGAAAGAGAGGGGAAGG + Intergenic
1173398367 20:42702040-42702062 AAGTGGGTAAACAGAGAGGGAGG - Intronic
1173547336 20:43908912-43908934 AAGAGTGTTAAGAGAGTGGGTGG + Intergenic
1173647307 20:44641475-44641497 ATGTGGGTCAAGAGAATGGCAGG + Intronic
1173969588 20:47141735-47141757 AAGTGAGAAAAGAGAGTGCATGG + Intronic
1174032598 20:47642063-47642085 AAGTGGTAAAAAAGAGTGAATGG - Intronic
1174931858 20:54824832-54824854 CAGTGGGTAAAGAGAGAGAGAGG + Intergenic
1176808804 21:13516623-13516645 AAGAGGGTGCAGAGAGTGGGGGG + Intergenic
1178017577 21:28367547-28367569 TCATGGGTATAGAGAGTGGAAGG - Intergenic
1178307590 21:31503416-31503438 AAGAGGAGAAAGAGAGAGGAAGG + Intronic
1178530853 21:33374499-33374521 AAGTGGGTCAAGAGGCTGAAAGG - Intergenic
1179116678 21:38499723-38499745 AAGGGGGGAAAGGGAGAGGAAGG + Intronic
1180901414 22:19376142-19376164 AAGTGGGAAAGGTGAGTGGCTGG - Intronic
1181382888 22:22520919-22520941 AAGCCTGTAAAGAGAGTGAAAGG - Intergenic
1181766037 22:25092784-25092806 AACAGGGAAAAGAGTGTGGAGGG + Intronic
1181859453 22:25806769-25806791 AACTTGGTAAAGAGAGAGTAGGG + Intronic
1182055838 22:27353991-27354013 AGGTGGGAAAAGGGAGAGGATGG - Intergenic
1182126078 22:27816799-27816821 AAGGAGGGAAAGAGAGAGGAAGG - Intergenic
1184119513 22:42440998-42441020 CAGTGGGGAAACAGAGTAGAGGG - Intergenic
1184306535 22:43606874-43606896 ATGTGGGAAATGAGAGTGGACGG - Intronic
1184863820 22:47191750-47191772 AAGCGGGGAGAGAGAGGGGAGGG + Intergenic
1185020874 22:48374113-48374135 AAGTGGGGAAGGGGATTGGAAGG - Intergenic
949433651 3:4004843-4004865 AATAGGGTAATGGGAGTGGAAGG - Intronic
949847143 3:8383253-8383275 AGGTGGGAAGAGAGAGAGGATGG - Intergenic
950047335 3:9956813-9956835 AAGTGGGAATTGAGAGTGAAAGG - Intergenic
950159779 3:10751580-10751602 AAGAGTGTAAAGAGGGTGGCAGG - Intergenic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951420517 3:22478944-22478966 AGCTGGGTAAAGAGAGAGGCAGG - Intergenic
952513077 3:34076464-34076486 GAGTGGGTGAACTGAGTGGAGGG + Intergenic
952806251 3:37355911-37355933 AAATAGGTAAAGAGATTGGGAGG - Intronic
952841952 3:37653880-37653902 AAGAGGATAAACAGAGTTGATGG + Intronic
953336399 3:42098048-42098070 AAGTGGGTAAGGAGAGATGGAGG - Intronic
953452047 3:43013749-43013771 AACTGGGTAAAGCCACTGGATGG + Intronic
953831027 3:46297671-46297693 ATGTGGGAAAAGAGAGGGGGAGG - Intergenic
954699818 3:52445357-52445379 AAGTGGGGAGAGAGCCTGGAAGG + Intergenic
954735929 3:52706392-52706414 AATTCGGGAAAGAGGGTGGACGG - Intronic
956302369 3:67786315-67786337 AAGAAGGTAAATAGTGTGGAAGG - Intergenic
956639112 3:71397957-71397979 GAGTGGGGAAAGAGAGAGAAGGG + Intronic
957676340 3:83371425-83371447 AAATTGATAAAGAGAATGGAAGG + Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
958603947 3:96333702-96333724 AAGAGAGTAAAGAGAGAGGAAGG - Intergenic
959219021 3:103491347-103491369 AAGTGGTGAAAGAGAGTAGAGGG + Intergenic
959449812 3:106485322-106485344 AAGAGAGTAAAGAGAGTACAAGG + Intergenic
960034802 3:113091721-113091743 AAGAGGGAAAAGAGAGAGGGAGG + Intergenic
960092060 3:113650820-113650842 AACTGGGGAAAGAGAAAGGAGGG - Exonic
960379096 3:116938311-116938333 AAATGGGGAAAGTGAGTAGATGG - Intronic
960784392 3:121356360-121356382 CAGTAGGTAAACAGAGTGGCCGG - Intronic
960919502 3:122732040-122732062 ATGTGAGAAAAGAGAGTGAAAGG - Intergenic
961546037 3:127634022-127634044 AGGTGGGTGCAGAGAGGGGAGGG + Intronic
961667960 3:128505318-128505340 AACTGGGTAAAGAATCTGGATGG - Intergenic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
961719272 3:128881706-128881728 AAGTGCGTCAACAGGGTGGAAGG - Intronic
963152000 3:142054831-142054853 AAGTGGGGAAAGACAGTGTTAGG + Intronic
963309032 3:143688009-143688031 AAAAGGGAAAAGAGAGAGGAAGG - Intronic
963839723 3:150093103-150093125 AAGTGGGGAGGGAGCGTGGAAGG + Intergenic
964036686 3:152207677-152207699 AAATGGGAAAAGGGAGTGAAGGG + Intergenic
964243202 3:154619833-154619855 AAGTAGGTAAAAAAAGTGGCTGG + Intergenic
964366593 3:155957105-155957127 AATTGGGGGAAGAGAGTGGAAGG + Intergenic
965874816 3:173303486-173303508 AAATGGGTAAAGACAAAGGAAGG + Intergenic
965973270 3:174589039-174589061 AAGTAGGTAAACAAAGTGGCTGG - Intronic
967058403 3:185850194-185850216 AAGTGGGCACAGAGAGTGAAGGG + Intergenic
967300499 3:188007960-188007982 AAGAGGGTAAGGAGCGTTGAAGG + Intergenic
967417024 3:189230487-189230509 AAGAGAGCAAAGAGAGTGGAGGG - Intronic
967613933 3:191542242-191542264 AAGGCAGAAAAGAGAGTGGAAGG - Intergenic
968835226 4:2958879-2958901 GAGGAGGAAAAGAGAGTGGAAGG + Intronic
969376115 4:6764344-6764366 GAGTGGGGAAAGAGAAAGGAAGG + Intergenic
969494985 4:7521367-7521389 AGGTGGGTGAACAGAGGGGAAGG - Intronic
969821934 4:9727439-9727461 AAGGTGGAAAAGTGAGTGGAGGG - Intergenic
970192333 4:13528524-13528546 AAGTGGGTAGAGGGTGAGGAGGG + Intergenic
971074978 4:23137694-23137716 GTGTGTGTACAGAGAGTGGAAGG + Intergenic
971117619 4:23666190-23666212 AAGTGAGTGAAGAGAGAGAAAGG - Intergenic
971216047 4:24663016-24663038 AACAGGACAAAGAGAGTGGAAGG + Intergenic
972358930 4:38308906-38308928 AAGGGGGAAAAGGGAGGGGAGGG - Intergenic
973163668 4:47050844-47050866 ATATGGAAAAAGAGAGTGGAAGG - Intronic
974127541 4:57714564-57714586 GAGTGGGTAAACAAAGTGGCTGG + Intergenic
974349350 4:60724440-60724462 CAGTGGGGAGAGAGAGTGGATGG - Intergenic
975576138 4:75864650-75864672 AACTGGGTAGAGGGAATGGAGGG - Intronic
976377858 4:84365302-84365324 AAGTTGGTAAAGAGCATGGTGGG - Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976521764 4:86035958-86035980 ATGTGGGTATAGAGAGTAAATGG + Intronic
976570629 4:86605189-86605211 AAGTGCCTTAGGAGAGTGGAGGG + Intronic
977653194 4:99492593-99492615 AAGTAGGTAAACAAAGTGGCTGG + Intergenic
977829732 4:101576523-101576545 AAGTAGGTAAACAAAGTGGCTGG + Intronic
978080674 4:104587299-104587321 AAGTGTGTAAACAGAGGAGAAGG - Intergenic
978286698 4:107086345-107086367 AAGAAGGGAAGGAGAGTGGAAGG + Intronic
978814639 4:112890123-112890145 AAGAGGTGAAAGAGAATGGAGGG - Intronic
979220360 4:118216275-118216297 AAGAGGGTTAAGAGGTTGGAAGG + Intronic
980818289 4:137977757-137977779 AGGTGGGTAAAGATAATGGTGGG + Intergenic
981423889 4:144581650-144581672 AAGCGGGTGAAGAGGCTGGAAGG + Intergenic
981812238 4:148789188-148789210 GAGTGGGTACAGATAGTGGAAGG + Intergenic
981849042 4:149206236-149206258 ATCTGGGGAAAGAGAGTGGATGG + Intergenic
984160893 4:176250919-176250941 AAGTGGGTAAAAAGAATGAAAGG - Intronic
984854787 4:184185535-184185557 AAGAGGGTGATGAGAGTGAAAGG - Intronic
985773948 5:1830813-1830835 AGGTGGCTACAGAGAGTGGGAGG - Intergenic
986138880 5:5010930-5010952 AAGTGGGTAAAGAGAAGACAAGG - Intergenic
986175018 5:5344564-5344586 AAAGGGGTAGGGAGAGTGGATGG - Intergenic
987415464 5:17656996-17657018 AAGTGGGGAAGGTGAGAGGAGGG - Intergenic
988275809 5:29079980-29080002 AAGAAGGAAAAGAGAGAGGAGGG + Intergenic
989522455 5:42418092-42418114 GAGTAGGTAAAGAAAGTGGCTGG - Intergenic
990514042 5:56515570-56515592 AAATGGGGAAAGAGAGATGAAGG + Intronic
990742681 5:58928288-58928310 AAGTGGGAAAAGGGAAGGGAAGG - Intergenic
990758017 5:59097464-59097486 ATGTGTGTTTAGAGAGTGGAGGG - Intronic
990978384 5:61579081-61579103 AAGTGAGTAAAGTGAAAGGATGG - Intergenic
991505944 5:67324292-67324314 AAGTGAGGAAAGAGAGGGGAAGG + Intergenic
991535595 5:67666495-67666517 GAGTAGGTAAAGAAAGTGGCAGG - Intergenic
992019281 5:72606375-72606397 AAGTGGGAATGAAGAGTGGATGG - Intergenic
993775722 5:91993274-91993296 AAGGGAGAAAAGAGAGAGGAAGG + Intergenic
998159217 5:139803707-139803729 AAGTGGGTTAAGAGGGTTTAGGG + Intronic
998494884 5:142579733-142579755 AATTGGAGAAAGAGATTGGAGGG + Intergenic
998607390 5:143648964-143648986 GAGTGGGTAGAGAGGGTGGCTGG + Intergenic
998821998 5:146065651-146065673 ACATGGGTGAAGAGACTGGAGGG - Intronic
999135494 5:149316119-149316141 AAATGGGTCAGGGGAGTGGAGGG - Intronic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
1000179883 5:158798580-158798602 AAGTGGGAAAAAAGAGGGAAGGG - Intronic
1001104423 5:168840977-168840999 AACTGGGTAAAGGGAATGGCAGG + Intronic
1001524660 5:172419984-172420006 ATCTGGGTAAAGAATGTGGAGGG + Intronic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002723426 5:181280098-181280120 AAGAGGGTAATGAGAGTGGGAGG - Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1004256507 6:14069286-14069308 GAGTGGGGAGAGAGAGAGGACGG + Intergenic
1004989785 6:21124556-21124578 TAGTGGGTAAAGGGAGTGGGAGG - Intronic
1005449532 6:25959372-25959394 AGCTGGGAAAAGAGAGTGGAGGG - Intergenic
1006003943 6:30987889-30987911 AACTAGGTAAAGAGTGTGGTTGG + Intronic
1006277073 6:33013651-33013673 ATGTGTGTAAAGAGAAAGGAGGG + Intergenic
1010667470 6:78647207-78647229 GAGTAGGTAAAGAAAGTGGCAGG + Intergenic
1011215748 6:85004001-85004023 AAGTGGGAAAAGGGAGTAAAGGG - Intergenic
1011446185 6:87443766-87443788 GAGTGGGGAGAGAGAGAGGAGGG - Intronic
1011775705 6:90728194-90728216 AAGTGGGTAGAGAGTGTGAGAGG - Intergenic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1011934374 6:92756290-92756312 ATATGGGGAAAGAGAGTGGATGG + Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1013806533 6:114002165-114002187 CAGTGGGAAAAGAAAGTGAAAGG + Intronic
1014269753 6:119323577-119323599 AAGTAGGTTAACAGAGTGGAAGG + Intronic
1016795141 6:148109969-148109991 AAGTAGGGAGAGAGAGAGGAAGG - Intergenic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1018608768 6:165625991-165626013 AAGTGGGCGAAGAGAGAGGTTGG + Intronic
1019080494 6:169426314-169426336 AGGTGAGGAAAGAGAGGGGATGG - Intergenic
1019721231 7:2572838-2572860 ACGTGGATAAAGAGAGAGGCCGG - Intronic
1019937460 7:4265731-4265753 AAGCGGGGAGAGGGAGTGGAGGG + Exonic
1021755236 7:23844996-23845018 GAGTAGGTAAACAGAGTGGCTGG + Intergenic
1022157168 7:27672225-27672247 AAGGGGGAAAAGTGAGTAGAGGG + Intergenic
1022361387 7:29662880-29662902 ATGTGGGCAAAGAGAGACGAAGG - Intergenic
1022467817 7:30663286-30663308 AAGTGAGTAAAGTGAGTCAAGGG + Intronic
1022863585 7:34393557-34393579 AAGTTGGTAAAGAAAGAGAATGG + Intergenic
1022935942 7:35176556-35176578 ATGTGGGCAAAGAGAGATGAAGG + Intergenic
1023596534 7:41835148-41835170 CAGTGGGGAAAGAGAGTGTCAGG - Intergenic
1024159891 7:46663427-46663449 GAGTGGGGAAGGGGAGTGGAAGG - Intergenic
1024309471 7:47956264-47956286 CAGTGGGAAAAGAGAGCGGGAGG + Intronic
1024404601 7:48963612-48963634 AAGTGGAAAAAGAGGCTGGAGGG - Intergenic
1026506043 7:70984862-70984884 AAGTGTGTCAAGCTAGTGGAGGG + Intergenic
1026893329 7:73995973-73995995 AAGTGCATAATGAGAGTGGCAGG + Intergenic
1028075470 7:86508391-86508413 GAGTGGGAAAAGAGAGTTGTTGG - Intergenic
1028161210 7:87486673-87486695 AAGTAGGTAGAGAGAGTGATGGG + Intergenic
1028725221 7:94078929-94078951 AAGTAGAGAAAGAGAGGGGATGG - Intergenic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1028982941 7:96987125-96987147 AAGTGGGAAAAGAAAGTTTAGGG - Intergenic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1030153273 7:106426973-106426995 AAGTGGGTCCAGAGAGGTGATGG + Intergenic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031422836 7:121569829-121569851 GAGTGGGGAAAGAGGTTGGAGGG - Intergenic
1032302818 7:130704892-130704914 AAGTGGCCAAAGGGAGTGGAAGG - Intergenic
1032606486 7:133360336-133360358 ATGTGGGAAAAGAGAATGGTTGG + Intronic
1032714992 7:134500583-134500605 AGGAGGGAAAAGAGAGGGGAGGG + Intergenic
1032984066 7:137317431-137317453 ATGTGGGTAAAGAGTGTGGGAGG + Intronic
1033919887 7:146377605-146377627 AAGTGGCTGTAGAGAGTGGCCGG - Intronic
1034088587 7:148343136-148343158 AATTGGGAACAGAGAGTGGAGGG - Intronic
1034630499 7:152526814-152526836 AACTGTGGAAAGAGGGTGGAGGG + Intergenic
1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG + Intergenic
1035277168 7:157754528-157754550 CAGTGGGTGCAGAGAATGGAAGG - Intronic
1035347977 7:158219209-158219231 ATGTGGGCCAAGAGAGTGGTTGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036500629 8:9310832-9310854 AAGAGGCTGAAGAGAGGGGAAGG - Intergenic
1036539042 8:9685667-9685689 CACTGGGTGAAGAGAGGGGAAGG - Intronic
1037305546 8:17499401-17499423 AAGGGGGGAGAGAGAATGGAGGG - Intronic
1037996483 8:23356213-23356235 ATTTGTGTAAACAGAGTGGATGG - Intronic
1038542645 8:28402301-28402323 AAGGAAGGAAAGAGAGTGGAGGG + Intronic
1038790975 8:30668037-30668059 CAGGAGGCAAAGAGAGTGGAAGG - Intergenic
1039167896 8:34706841-34706863 AAGGGGGAAAAGAGAGAGGTAGG - Intergenic
1040533254 8:48283081-48283103 GGGTGGGTGGAGAGAGTGGAGGG + Intergenic
1041360138 8:57044430-57044452 ATTTGTGAAAAGAGAGTGGAGGG + Intergenic
1042117276 8:65445980-65446002 AACTGGGTCAAGAGGTTGGAAGG - Intergenic
1043086158 8:75835988-75836010 CAGAGGGTAAAGAGAGAGCATGG + Intergenic
1043113064 8:76212757-76212779 AATTGTGTAAAGAAAGAGGATGG - Intergenic
1043336605 8:79183697-79183719 AAGTGGAGAAAGAGAGTAGAGGG - Intergenic
1043535995 8:81205086-81205108 GAGTAGGTAAACAAAGTGGATGG - Intergenic
1044124128 8:88437048-88437070 AAATGGGTAAAGGGAGGGGGAGG + Intergenic
1044191618 8:89325881-89325903 AAATGGGTAAGGACAGGGGAAGG + Intergenic
1044311022 8:90692614-90692636 AAGTAGGGAAAGAGAGTGGCAGG - Intronic
1044381515 8:91539621-91539643 AAGGGGGAAAAGAGAGATGAGGG - Intergenic
1044800716 8:95951617-95951639 AAATGGGGAGAGGGAGTGGAGGG + Intergenic
1045428402 8:102089636-102089658 AGGTGTGTAAAGAAAGTGAAAGG + Intronic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1048100139 8:131342194-131342216 AAGAGGGTAGGGAGAGTAGAGGG - Intergenic
1049596336 8:143485374-143485396 AAGTGGGTCAACAGTGAGGATGG + Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1050120771 9:2304944-2304966 AAGTGAGGAAACAGAGGGGAGGG + Intergenic
1051149548 9:14065504-14065526 GAGTGGGTGAAAAGAGTGGCGGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1053549926 9:39066947-39066969 AAAGGAGAAAAGAGAGTGGATGG - Intergenic
1053683989 9:40504906-40504928 AAGTAGATACAGAGAGTGGGGGG + Intergenic
1053814040 9:41887040-41887062 AAAGGAGAAAAGAGAGTGGATGG - Intergenic
1054395104 9:64644878-64644900 AAGTAGATACAGAGAGTGGGGGG + Intergenic
1054429751 9:65150078-65150100 AAGTAGATACAGAGAGTGGGGGG + Intergenic
1054616556 9:67300400-67300422 AAAGGAGAAAAGAGAGTGGATGG + Intergenic
1054791655 9:69262105-69262127 AAGATGGTAAAGAAAGAGGAAGG - Intergenic
1054826604 9:69579776-69579798 AAGTGGGTCAAGGAAGAGGAAGG + Intronic
1055189658 9:73502348-73502370 AAGTGGGGAGAGAAAGAGGAAGG - Intergenic
1056856235 9:90131988-90132010 CAGTGAGGAAAGAGAGTGGAAGG - Intergenic
1057991951 9:99779761-99779783 AAGGGGGTGAGGAGAGTGCAAGG - Intergenic
1058107419 9:100988549-100988571 TAGAGAGTAAAGAGAGAGGAGGG + Intergenic
1059041083 9:110816109-110816131 GGGTGGGAAAAGAGAGTAGAAGG + Intergenic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061281921 9:129602495-129602517 AAGGAGGGAAAGAGAGTGGAGGG + Intergenic
1062518906 9:136949593-136949615 GAGTGGGAAGAGAGAGGGGAGGG + Intronic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185811782 X:3117100-3117122 ATGTGGTTAAAGAAAATGGAAGG - Intergenic
1186173185 X:6899055-6899077 ATGTGGTTAAAGAGACTGGAGGG - Intergenic
1186697684 X:12054498-12054520 ATGTGGGTAATGAGAATGGGGGG - Intergenic
1187395509 X:18915751-18915773 AAGTGGCTAAATTGAGGGGATGG + Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189222656 X:39385506-39385528 AATTGGGTAATTAGATTGGAAGG - Intergenic
1189295783 X:39916631-39916653 AAGTGGGGAAAGAAAGGGGCAGG - Intergenic
1190327094 X:49213160-49213182 AAGTGGGTAATGGGAATGGAAGG + Intronic
1190434579 X:50410791-50410813 AAGTGGGAAAAGAGAGTTGAAGG + Intronic
1191692790 X:63958312-63958334 AACTGGGAAAAGAGAGAGGGTGG + Intergenic
1191730449 X:64329043-64329065 AAGTGGATAAAAAGTGTTGATGG + Intronic
1191942480 X:66496361-66496383 ACATGGGTATAGAGAGTAGAAGG - Intergenic
1192623764 X:72706772-72706794 TAGAGGGTAAAGGGAGTTGATGG - Intronic
1192821726 X:74653407-74653429 AAGTGGGCAAAGCGGGGGGACGG - Intergenic
1193380367 X:80809900-80809922 AAGGGGGTGGAGAGAGGGGAGGG + Intergenic
1193526190 X:82592363-82592385 GAGTGGGGAAAAAGAGAGGAAGG - Intergenic
1194456990 X:94116792-94116814 AAATGGTTAAAAAGAGAGGAGGG + Intergenic
1194656158 X:96576242-96576264 CAATGGGAAAAGAGAGTTGAGGG + Intergenic
1195335297 X:103847670-103847692 AAGTGGGCAAAGTTAGTTGATGG - Intergenic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1195467967 X:105201662-105201684 AAGTAGGGTAGGAGAGTGGAAGG - Intronic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197239680 X:124110052-124110074 GAGTAGGTAAACAGAGTGGCTGG - Intronic
1197747018 X:129938407-129938429 ATGTAGGTATAGAGAGTGGTGGG - Intergenic
1198229738 X:134677620-134677642 TAGTGAGTAAGGAGAGTGGTAGG + Intronic
1198518087 X:137428291-137428313 AAGTGGGCTGAGAGGGTGGAGGG - Intergenic
1199237936 X:145511773-145511795 AAGTGGTTATAGGGAGTTGAGGG - Intergenic
1199443196 X:147892309-147892331 TAGCAGCTAAAGAGAGTGGAAGG - Intergenic
1199598867 X:149528687-149528709 AAGAGGGTAGAGAGAGAGGGAGG - Intronic
1201269512 Y:12241254-12241276 ATGTGGTTAAAGAAAATGGAAGG + Intergenic