ID: 1131046230

View in Genome Browser
Species Human (GRCh38)
Location 15:89317965-89317987
Sequence TCTGCCACTCAGAACCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131046230_1131046232 -9 Left 1131046230 15:89317965-89317987 CCAAACTGGTTCTGAGTGGCAGA 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1131046232 15:89317979-89318001 AGTGGCAGATCAACATGGAACGG 0: 1
1: 0
2: 2
3: 18
4: 172
1131046230_1131046233 20 Left 1131046230 15:89317965-89317987 CCAAACTGGTTCTGAGTGGCAGA 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1131046233 15:89318008-89318030 TTAATTCATCCATATGAACTAGG 0: 1
1: 0
2: 1
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131046230 Original CRISPR TCTGCCACTCAGAACCAGTT TGG (reversed) Intronic
901209970 1:7519214-7519236 TCTGCCACTGAGGAGGAGTTTGG + Intronic
901406144 1:9047443-9047465 TCTGCACCTGAGAACCAGGTAGG + Intronic
902242641 1:15099160-15099182 TCAGCCTCCCAGAACCACTTGGG - Intronic
902536262 1:17120649-17120671 CCTGCCACTCAGAAGCAGCTGGG - Intergenic
903253927 1:22079036-22079058 TCTGCCCCTAAGAACCAGTTTGG - Intronic
905423540 1:37864857-37864879 TCTGCATATCAGAATCAGTTTGG + Intronic
908710300 1:67007096-67007118 CCTGACACTCAGAACCAGAGGGG + Intronic
909669042 1:78167600-78167622 CCTGTCACACAGAACAAGTTTGG + Intergenic
912115177 1:106397339-106397361 TCTGCAAATCAGAATCATTTGGG + Intergenic
913200216 1:116489906-116489928 TCTGCCACTTAGTAGCAGATAGG - Intergenic
916595033 1:166235324-166235346 TCTGCCTCTCATAGCCAGATAGG - Intergenic
1063601826 10:7489021-7489043 TCTTCCACTGAGCCCCAGTTAGG - Intergenic
1064410798 10:15102060-15102082 TCTGCCATTCACAACCAATCAGG - Intronic
1065753081 10:28906325-28906347 TCTTCCCCTCACATCCAGTTTGG + Intergenic
1067386272 10:45819878-45819900 TCTGCCTCTCAGAACCAACTCGG - Intergenic
1067447996 10:46364687-46364709 TCTGCCTCTCAGAACCCACTCGG + Intergenic
1067589381 10:47496074-47496096 TCTGCCTCTCAGAACCTACTCGG - Intergenic
1067876980 10:50016172-50016194 TCTGCCTCTCAGAACCCACTCGG + Intergenic
1070133057 10:73668137-73668159 TCTGCCTCTCAGAACCCACTCGG - Intergenic
1071078200 10:81779955-81779977 TCTCCCACTCTGAAGTAGTTAGG + Intergenic
1071608613 10:87015897-87015919 TCTGCCTCTCAGAACCCACTTGG + Intergenic
1073580158 10:104658207-104658229 TCTGCCACTGCAAACCGGTTTGG - Intronic
1074001483 10:109378069-109378091 TCTTCCACTCAGCTCCAGATTGG - Intergenic
1077423189 11:2462548-2462570 CCTGCCACTCAGTAACAGGTGGG - Intronic
1077922863 11:6654965-6654987 TCTCCCACTCAGAACACGTCTGG + Intronic
1082989439 11:59194883-59194905 TCAGCCACTCAGTACCAAATGGG - Intronic
1085271203 11:75271072-75271094 TCTGGCACTCAGCACCAGCCTGG + Intronic
1085810036 11:79671617-79671639 TCTGCCATGCATAAGCAGTTTGG + Intergenic
1088744773 11:112796181-112796203 TCTTTCAGGCAGAACCAGTTTGG + Intergenic
1090502913 11:127279292-127279314 TCTGCCACCCAGAACCAGAAGGG - Intergenic
1093734706 12:22607628-22607650 TGTGCCACCAATAACCAGTTTGG - Intergenic
1099348990 12:81541188-81541210 GCTGCTACACAGAATCAGTTAGG + Intronic
1100163959 12:91894977-91894999 ACTGCCACTCAGAAAAAGTTGGG + Intergenic
1103636226 12:122308171-122308193 TCTGTCACTCAGAACCAGAAGGG - Intronic
1103682304 12:122703948-122703970 TCTGCCATTCATCTCCAGTTAGG + Intergenic
1103684039 12:122717398-122717420 TCTGCCATTCATCTCCAGTTAGG + Intergenic
1106337080 13:28793313-28793335 TCTGCAACTGAGAAACAGTTTGG - Intergenic
1106562912 13:30862301-30862323 TTTCCCACTCAGCAACAGTTGGG + Intergenic
1108300404 13:49068651-49068673 TCTGCCACTGAGAGGCATTTAGG - Intronic
1108634867 13:52323306-52323328 ACTGCCGCTCAGAAGAAGTTGGG + Intergenic
1108652938 13:52499882-52499904 ACTGCCGCTCAGAAGAAGTTGGG - Intergenic
1110367798 13:74707515-74707537 TGTGGCACTCAGAAACAATTTGG - Intergenic
1112228954 13:97568720-97568742 TCTGCCACACAGACCCTGATTGG - Intergenic
1114267653 14:21082132-21082154 TCCGCCTCTTAGCACCAGTTGGG - Intronic
1114461730 14:22890554-22890576 TCTGAAATTCAGAACAAGTTGGG + Intergenic
1115417285 14:33150892-33150914 GCTTCCACTCACAACCAGATAGG + Intronic
1118767371 14:68918852-68918874 TCTGCCACATAGAAGCAGTCTGG + Intronic
1118789229 14:69074096-69074118 TCTGCCTTTCAAAACCTGTTGGG - Intronic
1120463680 14:84828354-84828376 TCTGACACTCACAAAGAGTTGGG + Intergenic
1125481992 15:40087514-40087536 TCTGCCACTGGGACCCAGTGAGG - Intergenic
1127968208 15:63939631-63939653 TCTGCCACTCAGAGACAGAATGG - Intronic
1131046230 15:89317965-89317987 TCTGCCACTCAGAACCAGTTTGG - Intronic
1135718740 16:24795899-24795921 TTTGCCACTCAGACCCTGTAAGG - Exonic
1138194442 16:55042093-55042115 TCTGCCACTAAGGAGCAGTGTGG + Intergenic
1138401552 16:56749051-56749073 GCTGCCACACAGCATCAGTTGGG + Intronic
1141171538 16:81694737-81694759 CCAGCCCCTCAGAACCACTTGGG - Intronic
1143795026 17:9329575-9329597 CCTGCCATTCAGACCCAGGTGGG - Intronic
1144675340 17:17158226-17158248 TCCCCCACTCAGAACCAGTTTGG + Intronic
1146579644 17:34025338-34025360 TCTGACACCCAGCACCATTTTGG - Intronic
1146775651 17:35612717-35612739 TCTGGGACTCAGAACTAGGTTGG - Intronic
1147632421 17:41940614-41940636 TCTGCCACTTAGAAGCTGTGTGG + Intronic
1148846290 17:50532155-50532177 TCTGTCAGTCATAACCATTTGGG + Intergenic
1152229485 17:79107312-79107334 GCTGCCACTCAGAACCTTTGGGG + Intronic
1153592449 18:6687774-6687796 TCTGCATCTCAGAACTGGTTAGG + Intergenic
1153721736 18:7910767-7910789 TCTGCCACCCAGAAAAAGTTGGG + Intronic
1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG + Intronic
1156919849 18:42508436-42508458 CCTGCCCCTCAGAATCACTTGGG - Intergenic
1157003824 18:43559061-43559083 CCTGCCTCTCATAACCAGATAGG - Intergenic
1157289655 18:46400453-46400475 TCTTCAACTCAGATCCAGTGGGG + Intronic
1159299336 18:66542928-66542950 TCTGCCACCAGGAACCAGTTCGG - Intronic
1160924151 19:1535087-1535109 CTCGCCACTCAGCACCAGTTGGG - Exonic
1162332081 19:10036448-10036470 TCTGCCTCTAAGAAGCAGTTGGG - Intergenic
1164806893 19:31123895-31123917 TCTGGCACTCAGCACCAGAATGG + Intergenic
1166503879 19:43359620-43359642 TCTGCCACTCACAAGCTGTGTGG + Intronic
1166506575 19:43375138-43375160 TCTGCCACTCACAAGCTGTGTGG - Intergenic
925265382 2:2563199-2563221 TCTGTCACTCGGAGACAGTTTGG + Intergenic
931131243 2:59338716-59338738 TCTGCCTCTTAAAACCAGTAAGG - Intergenic
935958560 2:108401599-108401621 TCTACCACTGAGTACCTGTTAGG - Intergenic
936125209 2:109783526-109783548 TCTGACACACAGAACCATTGGGG - Intergenic
936219484 2:110587942-110587964 TCTGACACACAGAACCATTGGGG + Intergenic
940585209 2:155639417-155639439 TATGCCACTGAAAGCCAGTTTGG - Intergenic
940677337 2:156740680-156740702 TCTGCCAGCCAGAACCAGACAGG - Intergenic
945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG + Intergenic
945735106 2:213589211-213589233 TCTGCCATTTAGAAGAAGTTTGG - Intronic
946450495 2:219774976-219774998 TCTGCCTTCCAGAACCAGATGGG - Intergenic
946576249 2:221078876-221078898 TCTGCCACTTATAAGCATTTAGG - Intergenic
947175024 2:227357424-227357446 TCTCCCATTCAGAATCAGTTGGG - Exonic
949066644 2:241994728-241994750 TCTGGCTCTCAAAACCAGCTGGG + Intergenic
1168872859 20:1145836-1145858 TCTGCCAACCAAAACCAGGTTGG - Intronic
1170288836 20:14744856-14744878 TCTTCCAGTCTGTACCAGTTTGG - Intronic
1172625270 20:36343078-36343100 TCTGGCCCTCAGCCCCAGTTTGG + Intronic
1172939054 20:38642252-38642274 TGTTCCATGCAGAACCAGTTTGG + Intronic
1173047036 20:39522376-39522398 TCTGGCACTCAGAAGCTGTGGGG - Intergenic
1174516422 20:51095802-51095824 TCTGCTGCTCAGTACAAGTTGGG + Intergenic
1174839121 20:53885124-53885146 TCTGCCACTTAGTACCAGCGTGG + Intergenic
1184505770 22:44901135-44901157 TCGGCCAATCAGTACCAGTCTGG + Intronic
950029166 3:9840576-9840598 TCTTCCCCTCAGAAGCAGCTGGG + Exonic
950634421 3:14304725-14304747 TCTGGCACTCACAACCAGTAAGG + Intergenic
951653829 3:24982253-24982275 GCTGCAACTCTGAACCAGGTGGG + Intergenic
953567540 3:44045677-44045699 CCTGTCACTCAGAACTTGTTTGG + Intergenic
954219727 3:49145633-49145655 TCTCTCACTCAGAATCATTTCGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956892611 3:73626918-73626940 TCTGTTTCTCAAAACCAGTTTGG - Intergenic
963313129 3:143730137-143730159 TCTGACAATCAGAACCAGAGAGG + Intronic
963681929 3:148388981-148389003 TCTTCCATTCATAACCACTTAGG + Intergenic
967056648 3:185835066-185835088 TCTGTCACTCTGAACCACGTTGG + Intergenic
968957190 4:3725426-3725448 TCAGCCCCTCAGAAGCAGCTTGG - Intergenic
971856369 4:32049458-32049480 TCTGCCACCAAGAAGCTGTTGGG - Intergenic
977801183 4:101234136-101234158 TCTGCCACTGATAAGCATTTAGG + Intronic
979908865 4:126334232-126334254 TCTGACACTCATAACCACATCGG + Intergenic
984058892 4:174966631-174966653 TCTGCCTTTCAGAACCACTGGGG + Intronic
984435583 4:179706249-179706271 TCTCCCACTCTGATACAGTTTGG + Intergenic
987433134 5:17861113-17861135 TCTGCCACTCAGATCCTCTGCGG - Intergenic
989471541 5:41825143-41825165 TCTGCCACTGAGAACATATTTGG - Intronic
993426541 5:87771615-87771637 TCTGTCATTCAGAACCACTGAGG - Intergenic
999357815 5:150953492-150953514 TCACCCACTCTGCACCAGTTAGG - Intergenic
999605713 5:153313393-153313415 TCTTCCACTCTGAACCTGTGGGG - Intergenic
999926066 5:156379529-156379551 TCTGTAAATCAGAACAAGTTTGG + Intronic
1001378496 5:171285567-171285589 TTTGCCACTCAGCACTATTTGGG - Intronic
1002445812 5:179289081-179289103 TGTGGCAGTCAGAACCAGCTGGG - Intronic
1003712228 6:8605027-8605049 TTTTCCATTCAAAACCAGTTTGG - Intergenic
1006628051 6:35411381-35411403 TCTGCCACTCACCAGCAGTGGGG + Intronic
1008270755 6:49486576-49486598 TCAACCAGTCACAACCAGTTTGG + Intronic
1016828169 6:148407107-148407129 ACTGCAACTCAAAATCAGTTAGG - Intronic
1018277223 6:162145996-162146018 TCTGCCACACAGAAAAGGTTGGG + Intronic
1019355108 7:574354-574376 TCTGCCTCTCAGCTCCAGCTGGG + Intronic
1020989553 7:15179954-15179976 TTTGCCACTCAGAGCCATCTTGG - Intergenic
1021392347 7:20108554-20108576 TCTCCCTCTCTGAACCATTTGGG - Intergenic
1021494728 7:21261604-21261626 TTTGCCACACAGTACCAATTGGG + Intergenic
1024450987 7:49542618-49542640 TCTGCCTTTCAAAACCAGTGGGG - Intergenic
1027852685 7:83468727-83468749 TCTGCCACTCACACCCAGCAGGG + Intronic
1031041096 7:116839137-116839159 AGTGGCACTCAGAACCAGTTTGG + Intronic
1034223673 7:149465236-149465258 TCTGCCCCTGAGAAAGAGTTAGG + Intergenic
1035832169 8:2708290-2708312 TCCGCCACTGAGGAACAGTTTGG + Intergenic
1036193337 8:6691737-6691759 TCTGCCACTGATAAGCATTTAGG + Intergenic
1036568066 8:9955049-9955071 GCTGCCAATTAGAACCACTTGGG + Intergenic
1037649568 8:20824176-20824198 TCTGCTGCTCTGAAGCAGTTTGG + Intergenic
1040419244 8:47223902-47223924 CCTGCCACTCAGTACCAGCAGGG + Intergenic
1043812945 8:84765245-84765267 TATGCCACTCAAACCCAGTTTGG - Intronic
1045676521 8:104614169-104614191 CCTGCCTCTCATAACCAGATGGG - Intronic
1046727288 8:117689698-117689720 TCTGGCACCGAGAACCAGTTTGG + Intergenic
1047846800 8:128814980-128815002 TCTGCCACTCAGAGACAGGCTGG + Intergenic
1047891461 8:129316110-129316132 TCTTCCACTCAGGAACAGCTGGG - Intergenic
1048666169 8:136663928-136663950 TCTGACACTCAGTACCACATTGG - Intergenic
1051812860 9:21069842-21069864 TCTGCCACTTTGTACCAGTATGG - Intergenic
1052592792 9:30520210-30520232 TCTCACACCCAGAAACAGTTCGG - Intergenic
1053148719 9:35729651-35729673 GATGTCACTCAGAACAAGTTTGG + Intronic
1055550328 9:77426953-77426975 TCTGCCACTCAGTACGCATTGGG + Intronic
1060120930 9:120988672-120988694 CATGCCACTCAAAACCATTTAGG - Intronic
1060609326 9:124947999-124948021 TCTGTCTCTGAGAAGCAGTTTGG - Intronic
1060887251 9:127163116-127163138 TCTGCCACTCTGAGCCAGCTGGG + Intronic
1061910650 9:133720829-133720851 TCTGTCACTCTGATACAGTTTGG - Intronic
1185506977 X:638926-638948 TCTGCCACAGAAAACCTGTTAGG + Intronic
1188779820 X:34268101-34268123 TCTGCCTCACAGAACAAGGTAGG - Intergenic
1193162184 X:78240614-78240636 TCTGCCACTGATATCCAGCTGGG + Intergenic
1193689245 X:84620378-84620400 ACTGCCACTGAAAAGCAGTTTGG - Intergenic
1194012987 X:88584752-88584774 TCTGCCTCTCATAACCAGACGGG + Intergenic
1199545269 X:149002197-149002219 TCAGCAACTCAGAAAAAGTTTGG + Intergenic
1199700634 X:150373071-150373093 ACAGCCACTCAGAACAGGTTTGG - Intronic
1200057876 X:153470897-153470919 CCTGCGACTCAGAGCCAGCTTGG - Intronic
1200988889 Y:9330371-9330393 TCTGCCTTTAAGAACCAGCTGGG + Intergenic