ID: 1131048879

View in Genome Browser
Species Human (GRCh38)
Location 15:89333680-89333702
Sequence CGGTTCCAGCTCCGGGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131048879_1131048889 1 Left 1131048879 15:89333680-89333702 CCAGCGCCCCGGAGCTGGAACCG 0: 1
1: 0
2: 2
3: 6
4: 111
Right 1131048889 15:89333704-89333726 CCCTGGCCCGACGGTGGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 117
1131048879_1131048894 21 Left 1131048879 15:89333680-89333702 CCAGCGCCCCGGAGCTGGAACCG 0: 1
1: 0
2: 2
3: 6
4: 111
Right 1131048894 15:89333724-89333746 CGGCCACCTTCCTCCAGAGCAGG 0: 1
1: 0
2: 5
3: 34
4: 258
1131048879_1131048886 -5 Left 1131048879 15:89333680-89333702 CCAGCGCCCCGGAGCTGGAACCG 0: 1
1: 0
2: 2
3: 6
4: 111
Right 1131048886 15:89333698-89333720 AACCGGCCCTGGCCCGACGGTGG 0: 1
1: 0
2: 0
3: 7
4: 56
1131048879_1131048896 24 Left 1131048879 15:89333680-89333702 CCAGCGCCCCGGAGCTGGAACCG 0: 1
1: 0
2: 2
3: 6
4: 111
Right 1131048896 15:89333727-89333749 CCACCTTCCTCCAGAGCAGGCGG 0: 1
1: 0
2: 6
3: 35
4: 329
1131048879_1131048885 -8 Left 1131048879 15:89333680-89333702 CCAGCGCCCCGGAGCTGGAACCG 0: 1
1: 0
2: 2
3: 6
4: 111
Right 1131048885 15:89333695-89333717 TGGAACCGGCCCTGGCCCGACGG 0: 1
1: 0
2: 1
3: 5
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131048879 Original CRISPR CGGTTCCAGCTCCGGGGCGC TGG (reversed) Exonic
901597696 1:10398622-10398644 CGGTCCCTGCTCCGGAGCGGAGG + Intronic
901653164 1:10754670-10754692 CGGTCCCAGCTGCGGGGAGGAGG - Intronic
903780943 1:25819853-25819875 CGGGTCCAGCTCGGTGGCGAGGG - Intronic
906636338 1:47412842-47412864 CGGCTCCAGCTCCGGGAAGCAGG + Intergenic
916588268 1:166166527-166166549 CGGCTCCAGCGCCCGGGCGGAGG + Exonic
919748650 1:201023560-201023582 CGGGCCCAGCCCCGGGGGGCCGG - Exonic
921930191 1:220748537-220748559 CGCTTCCAGCTCCTCCGCGCTGG + Exonic
1064981938 10:21174063-21174085 CGGCTCCGGCTCCGCGCCGCTGG + Intronic
1071553527 10:86585362-86585384 CGGTTCCCGCTGAGGGGCCCGGG - Intergenic
1073412103 10:103350869-103350891 CGGCTCCAGCTCAGGGGGCCGGG + Exonic
1074055969 10:109923242-109923264 CGGCTCCTGTTCCGGGGCTCCGG + Intronic
1083669402 11:64291793-64291815 CGGTGCGGGCTCCGGTGCGCGGG + Intronic
1084146148 11:67266415-67266437 CGGCGGCGGCTCCGGGGCGCGGG + Exonic
1085266758 11:75241945-75241967 GGCTTCCAGCTCCGGGCCGGCGG - Exonic
1090499113 11:127244328-127244350 CCGTTCCAGCTGGGGGGCTCAGG - Intergenic
1095800897 12:46269190-46269212 CGGTGCCAGCTTCAGTGCGCCGG - Intronic
1101865184 12:108515303-108515325 CGCTCCCAGCTCCGGGCCGCCGG - Exonic
1112506252 13:99978014-99978036 CGGATCCAGCTCAGGGCCGCGGG - Intergenic
1113772840 13:112922077-112922099 CGTTTCCAGCTCTGGGCCTCTGG - Intronic
1113821857 13:113220293-113220315 CGGTTCCAGCTCTGTTGTGCTGG + Intronic
1119456801 14:74763327-74763349 CGGGCCCAGCTCGGGAGCGCCGG + Intergenic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1124341198 15:28890101-28890123 AGGTTCCAGCTCTGGGACGCGGG - Intronic
1124965918 15:34433605-34433627 AGGTTCCAGCTCTGGGACTCGGG + Intronic
1124982537 15:34579704-34579726 GGGTTCCAGCTCTGGGACTCGGG + Intronic
1127257951 15:57307226-57307248 GGGTTCCAGCTCTTGGGAGCCGG - Intergenic
1128280109 15:66387308-66387330 CGCTTCCAACTCCGGGGGGAGGG - Exonic
1130002560 15:80059917-80059939 CGCTTCCGGCTCTCGGGCGCCGG - Intronic
1131048879 15:89333680-89333702 CGGTTCCAGCTCCGGGGCGCTGG - Exonic
1132178417 15:99733397-99733419 CGGTGGCAGCTGCGGGTCGCGGG - Exonic
1132677353 16:1126299-1126321 CGGTTCCAGCACCGGGGAGCTGG - Intergenic
1137351568 16:47718258-47718280 GGGTTCCTGCTCTGGGGCCCAGG + Intergenic
1138660956 16:58516494-58516516 CGGTGCCTGCTCCAGGGCACAGG + Exonic
1141171528 16:81694671-81694693 CGGTTCCAGCTCACGGGGCCTGG + Intronic
1142151532 16:88514598-88514620 AGATGCCAGCTCCGGGGCTCTGG + Intronic
1142763699 17:2054960-2054982 CGCCTCCAGCTCAGGTGCGCGGG + Intronic
1145041775 17:19582504-19582526 CAGTCCCAGCTCCTGGGAGCAGG - Intergenic
1145042636 17:19588204-19588226 CAGTCCCAGCTCCTGGGAGCAGG + Intergenic
1145295864 17:21592516-21592538 TGGAGCCAGCTCCGGGACGCCGG - Intergenic
1149800719 17:59565285-59565307 TGGTTCCAGCTCCGGGCAGAGGG + Intergenic
1151841787 17:76624074-76624096 CAGTGCCAGCTCCGGGCGGCAGG - Intergenic
1152072566 17:78141093-78141115 GGGTTACAGCTCCGCGCCGCTGG - Exonic
1152268160 17:79308243-79308265 CAGGCCCAGCTCCTGGGCGCTGG + Intronic
1152302474 17:79503322-79503344 CTGTGCCAGCTCCGGGGCAGAGG - Intronic
1152748978 17:82053857-82053879 CTGTTCCAGATCCTGGGAGCAGG - Exonic
1152755359 17:82084899-82084921 CGGGTCCACCTCCGGGACGTGGG + Exonic
1152855606 17:82663433-82663455 CGGTTCCAGCTCTGGGGCGGTGG - Intronic
1154044919 18:10895516-10895538 CTGTTCCAGCTGGGGGGCTCTGG - Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161933257 19:7355454-7355476 GGTTTCCAGCTCAGGGGCCCAGG - Intronic
1164693237 19:30226126-30226148 CGCGTCCAGCTCCGGGGACCCGG + Intergenic
1165916604 19:39264749-39264771 CGGCTCCAGGTCGCGGGCGCAGG + Intergenic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1167323598 19:48811122-48811144 CCGTCCCAGCTCCAGGGCGTCGG + Intergenic
925926140 2:8672041-8672063 TGGTACCAGCTCAGGGGCCCTGG - Intergenic
927508072 2:23627377-23627399 TTCTTCCAGCTCCTGGGCGCTGG - Intronic
929857851 2:45651247-45651269 CGGCCCCACCTCCTGGGCGCCGG - Intergenic
929857868 2:45651323-45651345 CCGATCCGGCTCGGGGGCGCAGG - Intronic
930762287 2:55049983-55050005 CGGCTGCCGCTCCGGGGCGACGG + Exonic
948862308 2:240758533-240758555 CGGTGCCAGCTGCTGAGCGCTGG - Intronic
1172109453 20:32536692-32536714 CTGTCCCAGCTCCGGGGAGAGGG - Intronic
1172295928 20:33811315-33811337 CGGGCCCAGCTGCGGGGCGGAGG + Exonic
1172978965 20:38926842-38926864 CACTTCCAGCCCCGCGGCGCTGG + Exonic
1175856469 20:62123137-62123159 AGGTGCCAGCTCCGAGGAGCAGG + Intronic
1176081077 20:63273205-63273227 AGATTCCAGATCCGGGGTGCGGG - Intronic
1179337831 21:40474561-40474583 CTGTTCCAGCTCAGGGGGGAAGG - Intronic
1180177764 21:46098558-46098580 CGGGTCCGGCTCCGGCCCGCGGG + Intronic
1182095244 22:27621468-27621490 TGGTTCCAGCCCCGGTGGGCAGG + Intergenic
1183290966 22:37001941-37001963 CGGTCCCAGCTTGGGGGCTCAGG - Exonic
1183335835 22:37245305-37245327 CCTTTCCAGCTCCGGGGGGAAGG + Intergenic
1183423542 22:37725687-37725709 CGGTTCACTCTCAGGGGCGCGGG - Exonic
1184583177 22:45430606-45430628 CACTCCCAGCTCCGGGGTGCAGG - Intronic
1185021578 22:48379780-48379802 CTGCTCCAGCTCTGGGGCTCTGG - Intergenic
950068886 3:10136379-10136401 TGGATCCTGCACCGGGGCGCAGG + Intergenic
950757217 3:15185329-15185351 GGTTTCCAGCTCCTGGGCTCAGG - Intergenic
955140106 3:56260442-56260464 CTGTTCCAGGGCTGGGGCGCGGG - Intronic
955387597 3:58492005-58492027 CGGCTCCAGCTGCCCGGCGCGGG - Intergenic
958004296 3:87792781-87792803 CGCCCCCAGCCCCGGGGCGCGGG - Intergenic
963236653 3:142963305-142963327 CGCCTGCAGCCCCGGGGCGCGGG - Exonic
965597057 3:170419979-170420001 CGGCTCCCGCTCCGCGCCGCTGG + Intronic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
967272171 3:187740969-187740991 CCGTTCCACCTCCCGGGCGGCGG - Intronic
968000178 3:195200192-195200214 CGGTTCCAGATCTGGCGCTCTGG + Intronic
968701287 4:2059361-2059383 CGGCGGCAGCTCAGGGGCGCGGG - Intergenic
976398523 4:84582961-84582983 CGAGTCCGGCTCCGGGGGGCGGG + Exonic
977885695 4:102250239-102250261 TGGATCCTGCACCGGGGCGCAGG + Intergenic
987352226 5:17032417-17032439 TGGATCCTGCACCGGGGCGCAGG + Intergenic
992690364 5:79235935-79235957 CGGCTCCAGCCCCGGGGAACTGG + Intronic
1000220342 5:159208928-159208950 CTGTTCCAGCTCCCGGGCCTCGG - Intronic
1002169156 5:177365874-177365896 CAGTTCCAGCTCCTGGGAGTCGG + Intronic
1005988069 6:30886375-30886397 AGGGTCCAGCGCCGGGGAGCAGG - Intronic
1006670678 6:35728097-35728119 GTGTTCCAGCCCCGGCGCGCTGG - Intronic
1017759442 6:157556708-157556730 CTGTTCCAGCCCCGGGGCCTCGG - Intronic
1018677637 6:166236635-166236657 GGGTTCCAGATAAGGGGCGCAGG + Intergenic
1018902018 6:168056414-168056436 CGGCTTCAGCTCCGGGGCAGTGG + Exonic
1019343088 7:517632-517654 TGGTTCCAGGGCCGGGGCGAGGG - Intronic
1022113496 7:27245046-27245068 AGGGTCCGGCTCCGAGGCGCTGG + Exonic
1029570208 7:101363648-101363670 CGGGTCCGGCTCCGGGGCTGCGG + Intronic
1031485343 7:122317063-122317085 GGGTCCGAGCTCGGGGGCGCGGG + Intergenic
1032193931 7:129779357-129779379 AGGGGCCAGCTCCGGGGCCCCGG + Intergenic
1032298838 7:130668501-130668523 CGGCTCCAGCTCCGGCCCCCTGG + Intronic
1034243179 7:149624876-149624898 CGGGGTCAGCTCCCGGGCGCGGG - Intergenic
1035422824 7:158743402-158743424 CGGCTGCAGCTCTGGGCCGCAGG - Intronic
1037503151 8:19505113-19505135 AGGTTCCAGCTCCAGGAGGCTGG - Intronic
1038720102 8:30027673-30027695 CGCTTCCAACTCCGGGGGGAGGG - Intergenic
1039595572 8:38787546-38787568 CGGCTCCAGCTCCTAGGGGCAGG - Exonic
1041502414 8:58553334-58553356 CGGTGCCAGGTCCCGGGCGCGGG + Intronic
1043516940 8:81003387-81003409 AGGTTCCAGCTCCAGGGATCCGG - Intronic
1046628215 8:116597860-116597882 CAGTTCCAGCTTTGGGGCTCTGG + Intergenic
1049649881 8:143760965-143760987 CGGGACCAGCTGCGGAGCGCAGG + Intergenic
1049973618 9:842000-842022 CGGCTCCGGCTCCGGGGCGTCGG + Exonic
1053550919 9:39078715-39078737 CAGTTCCCGCGCCGGGGAGCCGG + Exonic
1053815028 9:41898794-41898816 CAGTTCCCGCGCCGGGGAGCCGG + Exonic
1054615568 9:67288647-67288669 CAGTTCCCGCGCCGGGGAGCCGG - Intergenic
1060479262 9:124008598-124008620 CGGCCCCGGCTCCGTGGCGCCGG + Intronic
1060811770 9:126614360-126614382 CGGTTCCAGGGCCGCGGCGGCGG + Intergenic
1061486756 9:130924178-130924200 GGGTCCCAGCTCTGGGGAGCGGG - Intronic
1061766329 9:132883842-132883864 CGGATCCAGCTCCGGAGGGAAGG - Intronic
1062609758 9:137368713-137368735 GGCTTCCAGCCCCGGTGCGCAGG + Intronic
1200098156 X:153673755-153673777 CTGCACCTGCTCCGGGGCGCGGG - Intronic