ID: 1131049112

View in Genome Browser
Species Human (GRCh38)
Location 15:89334706-89334728
Sequence TGCCGTGGGCCTGGGGTCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 399}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049112_1131049128 13 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049112_1131049122 -3 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049112_1131049131 24 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049112_1131049129 14 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049129 15:89334743-89334765 GCGCGGCCTACGCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 92
1131049112_1131049127 12 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049127 15:89334741-89334763 TCGCGCGGCCTACGCAGCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049112 Original CRISPR TGCCGTGGGCCTGGGGTCGG GGG (reversed) Exonic