ID: 1131049115

View in Genome Browser
Species Human (GRCh38)
Location 15:89334709-89334731
Sequence CCGTGCCGTGGGCCTGGGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049115_1131049129 11 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049129 15:89334743-89334765 GCGCGGCCTACGCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 92
1131049115_1131049131 21 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049115_1131049127 9 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049127 15:89334741-89334763 TCGCGCGGCCTACGCAGCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 35
1131049115_1131049128 10 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049115_1131049122 -6 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049115 Original CRISPR CCGTGCCGTGGGCCTGGGGT CGG (reversed) Exonic