ID: 1131049119

View in Genome Browser
Species Human (GRCh38)
Location 15:89334715-89334737
Sequence GGGACGCCGTGCCGTGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049119_1131049127 3 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049127 15:89334741-89334763 TCGCGCGGCCTACGCAGCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 35
1131049119_1131049131 15 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049119_1131049133 26 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049119_1131049134 30 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049119_1131049129 5 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049129 15:89334743-89334765 GCGCGGCCTACGCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 92
1131049119_1131049128 4 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049119 Original CRISPR GGGACGCCGTGCCGTGGGCC TGG (reversed) Exonic