ID: 1131049120

View in Genome Browser
Species Human (GRCh38)
Location 15:89334720-89334742
Sequence GAAGGGGGACGCCGTGCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049120_1131049134 25 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049120_1131049131 10 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049120_1131049129 0 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049129 15:89334743-89334765 GCGCGGCCTACGCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 92
1131049120_1131049128 -1 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049120_1131049127 -2 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049127 15:89334741-89334763 TCGCGCGGCCTACGCAGCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 35
1131049120_1131049133 21 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049120 Original CRISPR GAAGGGGGACGCCGTGCCGT GGG (reversed) Exonic