ID: 1131049121

View in Genome Browser
Species Human (GRCh38)
Location 15:89334721-89334743
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049121_1131049129 -1 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049129 15:89334743-89334765 GCGCGGCCTACGCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 92
1131049121_1131049134 24 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049121_1131049133 20 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049121_1131049131 9 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049121_1131049127 -3 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049127 15:89334741-89334763 TCGCGCGGCCTACGCAGCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 35
1131049121_1131049128 -2 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049121 Original CRISPR CGAAGGGGGACGCCGTGCCG TGG (reversed) Exonic