ID: 1131049122

View in Genome Browser
Species Human (GRCh38)
Location 15:89334726-89334748
Sequence GCACGGCGTCCCCCTTCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 18}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049108_1131049122 11 Left 1131049108 15:89334692-89334714 CCCGGTCTGCTGCTCCCCCGACC 0: 1
1: 0
2: 5
3: 18
4: 253
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049113_1131049122 -4 Left 1131049113 15:89334707-89334729 CCCCGACCCCAGGCCCACGGCAC 0: 1
1: 0
2: 5
3: 30
4: 394
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049115_1131049122 -6 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049107_1131049122 24 Left 1131049107 15:89334679-89334701 CCTCACGGTGCTTCCCGGTCTGC 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049112_1131049122 -3 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049114_1131049122 -5 Left 1131049114 15:89334708-89334730 CCCGACCCCAGGCCCACGGCACG 0: 1
1: 0
2: 1
3: 24
4: 275
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049117_1131049122 -10 Left 1131049117 15:89334713-89334735 CCCCAGGCCCACGGCACGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1131049109_1131049122 10 Left 1131049109 15:89334693-89334715 CCGGTCTGCTGCTCCCCCGACCC 0: 1
1: 0
2: 3
3: 47
4: 427
Right 1131049122 15:89334726-89334748 GCACGGCGTCCCCCTTCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049122 Original CRISPR GCACGGCGTCCCCCTTCGCG CGG Exonic