ID: 1131049125

View in Genome Browser
Species Human (GRCh38)
Location 15:89334737-89334759
Sequence GGCTGCGTAGGCCGCGCGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049125_1131049134 8 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049125_1131049131 -7 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049125_1131049137 21 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049137 15:89334781-89334803 ACCCGGCCGGTCCGCTTCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1131049125_1131049133 4 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049125 Original CRISPR GGCTGCGTAGGCCGCGCGAA GGG (reversed) Exonic