ID: 1131049126

View in Genome Browser
Species Human (GRCh38)
Location 15:89334738-89334760
Sequence AGGCTGCGTAGGCCGCGCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049126_1131049137 20 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049137 15:89334781-89334803 ACCCGGCCGGTCCGCTTCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1131049126_1131049134 7 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049126_1131049133 3 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049126_1131049131 -8 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049126 Original CRISPR AGGCTGCGTAGGCCGCGCGA AGG (reversed) Exonic