ID: 1131049128

View in Genome Browser
Species Human (GRCh38)
Location 15:89334742-89334764
Sequence CGCGCGGCCTACGCAGCCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049108_1131049128 27 Left 1131049108 15:89334692-89334714 CCCGGTCTGCTGCTCCCCCGACC 0: 1
1: 0
2: 5
3: 18
4: 253
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049109_1131049128 26 Left 1131049109 15:89334693-89334715 CCGGTCTGCTGCTCCCCCGACCC 0: 1
1: 0
2: 3
3: 47
4: 427
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049114_1131049128 11 Left 1131049114 15:89334708-89334730 CCCGACCCCAGGCCCACGGCACG 0: 1
1: 0
2: 1
3: 24
4: 275
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049113_1131049128 12 Left 1131049113 15:89334707-89334729 CCCCGACCCCAGGCCCACGGCAC 0: 1
1: 0
2: 5
3: 30
4: 394
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049112_1131049128 13 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049117_1131049128 6 Left 1131049117 15:89334713-89334735 CCCCAGGCCCACGGCACGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049119_1131049128 4 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049120_1131049128 -1 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049115_1131049128 10 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049118_1131049128 5 Left 1131049118 15:89334714-89334736 CCCAGGCCCACGGCACGGCGTCC 0: 1
1: 0
2: 1
3: 3
4: 121
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1131049121_1131049128 -2 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049128 15:89334742-89334764 CGCGCGGCCTACGCAGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049128 Original CRISPR CGCGCGGCCTACGCAGCCTC GGG Exonic