ID: 1131049130

View in Genome Browser
Species Human (GRCh38)
Location 15:89334749-89334771
Sequence ACGCTACCCCGAGGCTGCGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049130_1131049133 -8 Left 1131049130 15:89334749-89334771 CCTACGCAGCCTCGGGGTAGCGT 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049130_1131049137 9 Left 1131049130 15:89334749-89334771 CCTACGCAGCCTCGGGGTAGCGT 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1131049137 15:89334781-89334803 ACCCGGCCGGTCCGCTTCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1131049130_1131049134 -4 Left 1131049130 15:89334749-89334771 CCTACGCAGCCTCGGGGTAGCGT 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049130 Original CRISPR ACGCTACCCCGAGGCTGCGT AGG (reversed) Exonic