ID: 1131049131

View in Genome Browser
Species Human (GRCh38)
Location 15:89334753-89334775
Sequence CGCAGCCTCGGGGTAGCGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049121_1131049131 9 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049117_1131049131 17 Left 1131049117 15:89334713-89334735 CCCCAGGCCCACGGCACGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049123_1131049131 -5 Left 1131049123 15:89334735-89334757 CCCCCTTCGCGCGGCCTACGCAG 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049120_1131049131 10 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049124_1131049131 -6 Left 1131049124 15:89334736-89334758 CCCCTTCGCGCGGCCTACGCAGC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049112_1131049131 24 Left 1131049112 15:89334706-89334728 CCCCCGACCCCAGGCCCACGGCA 0: 1
1: 0
2: 2
3: 36
4: 399
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049113_1131049131 23 Left 1131049113 15:89334707-89334729 CCCCGACCCCAGGCCCACGGCAC 0: 1
1: 0
2: 5
3: 30
4: 394
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049115_1131049131 21 Left 1131049115 15:89334709-89334731 CCGACCCCAGGCCCACGGCACGG 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049114_1131049131 22 Left 1131049114 15:89334708-89334730 CCCGACCCCAGGCCCACGGCACG 0: 1
1: 0
2: 1
3: 24
4: 275
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049118_1131049131 16 Left 1131049118 15:89334714-89334736 CCCAGGCCCACGGCACGGCGTCC 0: 1
1: 0
2: 1
3: 3
4: 121
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049126_1131049131 -8 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049125_1131049131 -7 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1131049119_1131049131 15 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049131 Original CRISPR CGCAGCCTCGGGGTAGCGTG TGG Exonic