ID: 1131049133

View in Genome Browser
Species Human (GRCh38)
Location 15:89334764-89334786
Sequence GGTAGCGTGTGGCCTCCACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049118_1131049133 27 Left 1131049118 15:89334714-89334736 CCCAGGCCCACGGCACGGCGTCC 0: 1
1: 0
2: 1
3: 3
4: 121
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049119_1131049133 26 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049123_1131049133 6 Left 1131049123 15:89334735-89334757 CCCCCTTCGCGCGGCCTACGCAG 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049124_1131049133 5 Left 1131049124 15:89334736-89334758 CCCCTTCGCGCGGCCTACGCAGC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049125_1131049133 4 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049117_1131049133 28 Left 1131049117 15:89334713-89334735 CCCCAGGCCCACGGCACGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049121_1131049133 20 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049130_1131049133 -8 Left 1131049130 15:89334749-89334771 CCTACGCAGCCTCGGGGTAGCGT 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049120_1131049133 21 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1131049126_1131049133 3 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049133 15:89334764-89334786 GGTAGCGTGTGGCCTCCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049133 Original CRISPR GGTAGCGTGTGGCCTCCACC CGG Exonic