ID: 1131049134

View in Genome Browser
Species Human (GRCh38)
Location 15:89334768-89334790
Sequence GCGTGTGGCCTCCACCCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131049121_1131049134 24 Left 1131049121 15:89334721-89334743 CCACGGCACGGCGTCCCCCTTCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049126_1131049134 7 Left 1131049126 15:89334738-89334760 CCTTCGCGCGGCCTACGCAGCCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049120_1131049134 25 Left 1131049120 15:89334720-89334742 CCCACGGCACGGCGTCCCCCTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049119_1131049134 30 Left 1131049119 15:89334715-89334737 CCAGGCCCACGGCACGGCGTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049123_1131049134 10 Left 1131049123 15:89334735-89334757 CCCCCTTCGCGCGGCCTACGCAG 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049124_1131049134 9 Left 1131049124 15:89334736-89334758 CCCCTTCGCGCGGCCTACGCAGC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049125_1131049134 8 Left 1131049125 15:89334737-89334759 CCCTTCGCGCGGCCTACGCAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77
1131049130_1131049134 -4 Left 1131049130 15:89334749-89334771 CCTACGCAGCCTCGGGGTAGCGT 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131049134 Original CRISPR GCGTGTGGCCTCCACCCGGC CGG Exonic