ID: 1131050381

View in Genome Browser
Species Human (GRCh38)
Location 15:89343618-89343640
Sequence GCACCCTGCTTTGCTCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131050369_1131050381 14 Left 1131050369 15:89343581-89343603 CCAGCCCCAGTCAGGAACAGCAC No data
Right 1131050381 15:89343618-89343640 GCACCCTGCTTTGCTCAGATGGG No data
1131050371_1131050381 10 Left 1131050371 15:89343585-89343607 CCCCAGTCAGGAACAGCACGGAG No data
Right 1131050381 15:89343618-89343640 GCACCCTGCTTTGCTCAGATGGG No data
1131050372_1131050381 9 Left 1131050372 15:89343586-89343608 CCCAGTCAGGAACAGCACGGAGG No data
Right 1131050381 15:89343618-89343640 GCACCCTGCTTTGCTCAGATGGG No data
1131050374_1131050381 8 Left 1131050374 15:89343587-89343609 CCAGTCAGGAACAGCACGGAGGG No data
Right 1131050381 15:89343618-89343640 GCACCCTGCTTTGCTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131050381 Original CRISPR GCACCCTGCTTTGCTCAGAT GGG Intergenic
No off target data available for this crispr