ID: 1131051602

View in Genome Browser
Species Human (GRCh38)
Location 15:89351803-89351825
Sequence GTGTGTAAGCAGAACCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131051602_1131051605 10 Left 1131051602 15:89351803-89351825 CCCTCATGGTTCTGCTTACACAC No data
Right 1131051605 15:89351836-89351858 AGAGAGCTCACCAACTCTGCAGG No data
1131051602_1131051608 30 Left 1131051602 15:89351803-89351825 CCCTCATGGTTCTGCTTACACAC No data
Right 1131051608 15:89351856-89351878 AGGAAGCCCATCTCCTAACTGGG No data
1131051602_1131051607 29 Left 1131051602 15:89351803-89351825 CCCTCATGGTTCTGCTTACACAC No data
Right 1131051607 15:89351855-89351877 CAGGAAGCCCATCTCCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131051602 Original CRISPR GTGTGTAAGCAGAACCATGA GGG (reversed) Intergenic
No off target data available for this crispr