ID: 1131053392

View in Genome Browser
Species Human (GRCh38)
Location 15:89362313-89362335
Sequence TGCGACTCCCAGGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131053380_1131053392 24 Left 1131053380 15:89362266-89362288 CCGAGTGAGTCTGGCAGCGCGGG 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1131053392 15:89362313-89362335 TGCGACTCCCAGGGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131053392 Original CRISPR TGCGACTCCCAGGGAAAAGC TGG Intergenic
No off target data available for this crispr