ID: 1131054657

View in Genome Browser
Species Human (GRCh38)
Location 15:89368317-89368339
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131054645_1131054657 7 Left 1131054645 15:89368287-89368309 CCAGTCCTCCTCTTTCCTGGTCC No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054641_1131054657 10 Left 1131054641 15:89368284-89368306 CCCCCAGTCCTCCTCTTTCCTGG No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054644_1131054657 8 Left 1131054644 15:89368286-89368308 CCCAGTCCTCCTCTTTCCTGGTC No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054647_1131054657 -1 Left 1131054647 15:89368295-89368317 CCTCTTTCCTGGTCCCCCACCCC No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054646_1131054657 2 Left 1131054646 15:89368292-89368314 CCTCCTCTTTCCTGGTCCCCCAC No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054648_1131054657 -8 Left 1131054648 15:89368302-89368324 CCTGGTCCCCCACCCCTATCCCC No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054643_1131054657 9 Left 1131054643 15:89368285-89368307 CCCCAGTCCTCCTCTTTCCTGGT No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data
1131054640_1131054657 18 Left 1131054640 15:89368276-89368298 CCAGCTTTCCCCCAGTCCTCCTC No data
Right 1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131054657 Original CRISPR CTATCCCCCAGCGCCGGAGC AGG Intergenic