ID: 1131054732

View in Genome Browser
Species Human (GRCh38)
Location 15:89368561-89368583
Sequence AGGCCGCATTGTTAGCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131054732_1131054738 25 Left 1131054732 15:89368561-89368583 CCCTGCCGCTAACAATGCGGCCT No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data
1131054732_1131054741 30 Left 1131054732 15:89368561-89368583 CCCTGCCGCTAACAATGCGGCCT No data
Right 1131054741 15:89368614-89368636 AGCGCCATTAGCATACGGCTGGG No data
1131054732_1131054740 29 Left 1131054732 15:89368561-89368583 CCCTGCCGCTAACAATGCGGCCT No data
Right 1131054740 15:89368613-89368635 GAGCGCCATTAGCATACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131054732 Original CRISPR AGGCCGCATTGTTAGCGGCA GGG (reversed) Intergenic
No off target data available for this crispr