ID: 1131054733

View in Genome Browser
Species Human (GRCh38)
Location 15:89368562-89368584
Sequence AAGGCCGCATTGTTAGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131054733_1131054741 29 Left 1131054733 15:89368562-89368584 CCTGCCGCTAACAATGCGGCCTT No data
Right 1131054741 15:89368614-89368636 AGCGCCATTAGCATACGGCTGGG No data
1131054733_1131054742 30 Left 1131054733 15:89368562-89368584 CCTGCCGCTAACAATGCGGCCTT No data
Right 1131054742 15:89368615-89368637 GCGCCATTAGCATACGGCTGGGG No data
1131054733_1131054740 28 Left 1131054733 15:89368562-89368584 CCTGCCGCTAACAATGCGGCCTT No data
Right 1131054740 15:89368613-89368635 GAGCGCCATTAGCATACGGCTGG No data
1131054733_1131054738 24 Left 1131054733 15:89368562-89368584 CCTGCCGCTAACAATGCGGCCTT No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131054733 Original CRISPR AAGGCCGCATTGTTAGCGGC AGG (reversed) Intergenic
No off target data available for this crispr