ID: 1131054735

View in Genome Browser
Species Human (GRCh38)
Location 15:89368581-89368603
Sequence CTCGTCGAATAATTCGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131054735_1131054743 12 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054743 15:89368616-89368638 CGCCATTAGCATACGGCTGGGGG No data
1131054735_1131054741 10 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054741 15:89368614-89368636 AGCGCCATTAGCATACGGCTGGG No data
1131054735_1131054740 9 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054740 15:89368613-89368635 GAGCGCCATTAGCATACGGCTGG No data
1131054735_1131054738 5 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data
1131054735_1131054744 13 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054744 15:89368617-89368639 GCCATTAGCATACGGCTGGGGGG No data
1131054735_1131054742 11 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054742 15:89368615-89368637 GCGCCATTAGCATACGGCTGGGG No data
1131054735_1131054746 20 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054746 15:89368624-89368646 GCATACGGCTGGGGGGTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131054735 Original CRISPR CTCGTCGAATAATTCGATAA AGG (reversed) Intergenic
No off target data available for this crispr