ID: 1131054738

View in Genome Browser
Species Human (GRCh38)
Location 15:89368609-89368631
Sequence CCCTGAGCGCCATTAGCATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131054732_1131054738 25 Left 1131054732 15:89368561-89368583 CCCTGCCGCTAACAATGCGGCCT No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data
1131054733_1131054738 24 Left 1131054733 15:89368562-89368584 CCTGCCGCTAACAATGCGGCCTT No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data
1131054735_1131054738 5 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data
1131054734_1131054738 20 Left 1131054734 15:89368566-89368588 CCGCTAACAATGCGGCCTTTATC No data
Right 1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131054738 Original CRISPR CCCTGAGCGCCATTAGCATA CGG Intergenic
No off target data available for this crispr