ID: 1131054742

View in Genome Browser
Species Human (GRCh38)
Location 15:89368615-89368637
Sequence GCGCCATTAGCATACGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131054735_1131054742 11 Left 1131054735 15:89368581-89368603 CCTTTATCGAATTATTCGACGAG No data
Right 1131054742 15:89368615-89368637 GCGCCATTAGCATACGGCTGGGG No data
1131054734_1131054742 26 Left 1131054734 15:89368566-89368588 CCGCTAACAATGCGGCCTTTATC No data
Right 1131054742 15:89368615-89368637 GCGCCATTAGCATACGGCTGGGG No data
1131054733_1131054742 30 Left 1131054733 15:89368562-89368584 CCTGCCGCTAACAATGCGGCCTT No data
Right 1131054742 15:89368615-89368637 GCGCCATTAGCATACGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131054742 Original CRISPR GCGCCATTAGCATACGGCTG GGG Intergenic
No off target data available for this crispr