ID: 1131055240

View in Genome Browser
Species Human (GRCh38)
Location 15:89371079-89371101
Sequence CTCACGGAAGGTCGCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131055229_1131055240 26 Left 1131055229 15:89371030-89371052 CCCATTCCTTTCATTTTACACCT No data
Right 1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG No data
1131055228_1131055240 27 Left 1131055228 15:89371029-89371051 CCCCATTCCTTTCATTTTACACC No data
Right 1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG No data
1131055234_1131055240 6 Left 1131055234 15:89371050-89371072 CCTAGAAATGGTGTAAAAAGGCC No data
Right 1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG No data
1131055230_1131055240 25 Left 1131055230 15:89371031-89371053 CCATTCCTTTCATTTTACACCTA No data
Right 1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG No data
1131055231_1131055240 20 Left 1131055231 15:89371036-89371058 CCTTTCATTTTACACCTAGAAAT No data
Right 1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131055240 Original CRISPR CTCACGGAAGGTCGCACAGA AGG Intergenic
No off target data available for this crispr