ID: 1131056096

View in Genome Browser
Species Human (GRCh38)
Location 15:89376030-89376052
Sequence CTGGGGTAATGGAGAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131056096_1131056103 2 Left 1131056096 15:89376030-89376052 CCTTGTCCTCTCCATTACCCCAG No data
Right 1131056103 15:89376055-89376077 CTGATGTCTCCCAAGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131056096 Original CRISPR CTGGGGTAATGGAGAGGACA AGG (reversed) Intergenic
No off target data available for this crispr