ID: 1131056302

View in Genome Browser
Species Human (GRCh38)
Location 15:89377402-89377424
Sequence GATTTGAAGGGACCAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131056298_1131056302 10 Left 1131056298 15:89377369-89377391 CCTGGGGAGGGGGAGCATGTAAA No data
Right 1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG No data
1131056294_1131056302 22 Left 1131056294 15:89377357-89377379 CCAGCTTGGCTGCCTGGGGAGGG No data
Right 1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG No data
1131056292_1131056302 23 Left 1131056292 15:89377356-89377378 CCCAGCTTGGCTGCCTGGGGAGG No data
Right 1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131056302 Original CRISPR GATTTGAAGGGACCAGGATC TGG Intergenic
No off target data available for this crispr